ID: 931869774

View in Genome Browser
Species Human (GRCh38)
Location 2:66445450-66445472
Sequence GTTCAGCGCCCCGGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931869774_931869780 -3 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869780 2:66445470-66445492 AACCCCTAGTGCGGCGTCCTGGG 0: 1
1: 0
2: 0
3: 0
4: 19
931869774_931869788 8 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869788 2:66445481-66445503 CGGCGTCCTGGGGGCCGGGCAGG 0: 1
1: 0
2: 7
3: 38
4: 479
931869774_931869783 -1 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869783 2:66445472-66445494 CCCCTAGTGCGGCGTCCTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
931869774_931869787 4 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869787 2:66445477-66445499 AGTGCGGCGTCCTGGGGGCCGGG 0: 1
1: 0
2: 0
3: 13
4: 246
931869774_931869781 -2 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869781 2:66445471-66445493 ACCCCTAGTGCGGCGTCCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 35
931869774_931869791 16 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869791 2:66445489-66445511 TGGGGGCCGGGCAGGAAGGATGG 0: 1
1: 0
2: 12
3: 102
4: 1117
931869774_931869779 -4 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869779 2:66445469-66445491 GAACCCCTAGTGCGGCGTCCTGG 0: 1
1: 0
2: 0
3: 0
4: 17
931869774_931869786 3 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869786 2:66445476-66445498 TAGTGCGGCGTCCTGGGGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 107
931869774_931869789 12 Left 931869774 2:66445450-66445472 CCTGTCCCTCCGGGGCGCTGAAC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 931869789 2:66445485-66445507 GTCCTGGGGGCCGGGCAGGAAGG 0: 1
1: 1
2: 6
3: 64
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931869774 Original CRISPR GTTCAGCGCCCCGGAGGGAC AGG (reversed) Intronic
900802759 1:4747513-4747535 GTTCAGTGCCTAGGAGGGAAGGG - Intronic
907841094 1:58158286-58158308 GTTCAGAGCCCAGGGGGGAAAGG + Intronic
909402636 1:75251231-75251253 GTTTAGCAACACGGAGGGACTGG + Exonic
1067561960 10:47310450-47310472 TTTCAGCGCCCGGAAGGGGCTGG - Exonic
1077105165 11:839063-839085 GTTCAGAGCCCCTGGGGGAGAGG + Intronic
1078157430 11:8810923-8810945 GTTCAGAGCCCCTGTTGGACTGG - Intronic
1078527338 11:12110816-12110838 GTCCAACGCCCGGGAGGGTCAGG + Intronic
1085266991 11:75242905-75242927 GGTCAGCGCCCTGGTGGGAAAGG - Exonic
1089618718 11:119709972-119709994 GCTCAGCCCCCAGGATGGACGGG + Intronic
1091857772 12:3753127-3753149 GTTCAGCTCCGCTGAGGGGCTGG - Intronic
1092114891 12:5993229-5993251 CTCCAGCACCCCTGAGGGACAGG + Intronic
1092216704 12:6688871-6688893 GTTCAGCTCCCTGGAGGGGAAGG - Intronic
1102369216 12:112367478-112367500 GTTCAGAACCCCTGAGGGAAAGG + Intronic
1104992851 12:132635798-132635820 GCTCAGGGCCCCGGCGGGCCTGG - Intronic
1122959812 14:105089315-105089337 GTTCAGCGCCCTGCAAGGGCAGG + Intergenic
1128866022 15:71115671-71115693 GGTCCGCGTCCCGGAGCGACCGG - Intronic
1129270241 15:74415741-74415763 GTTCAGTGTCCAGTAGGGACAGG - Intronic
1135652187 16:24216135-24216157 GTTCAGCCACTCGGAGGGGCGGG + Exonic
1141169017 16:81679694-81679716 GTTCAGGGACGGGGAGGGACAGG - Intronic
1142226791 16:88881510-88881532 CTTCAGCACCTCAGAGGGACCGG + Intronic
1143769784 17:9161294-9161316 GTCCAGAGCCCCAGAGGGGCAGG + Intronic
1148543807 17:48501677-48501699 CTTCAGGGCCCAGGAAGGACTGG - Intergenic
1152891782 17:82886089-82886111 GTCCAGCCCCAAGGAGGGACAGG - Intronic
1153445966 18:5173570-5173592 ATTCAGCGCCCCAGAGGGCAGGG + Intronic
1157335414 18:46733982-46734004 GGTCAGAGCCCCCTAGGGACGGG - Intronic
1160551365 18:79695603-79695625 GCTCAGCGGCCCAGAGGGAGGGG - Intronic
1160700817 19:506529-506551 GGGCAACGCCCCTGAGGGACGGG + Intergenic
1161390253 19:4016927-4016949 CTTCAGCGCCCCTGAGGTTCTGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG + Exonic
1163343836 19:16727362-16727384 GTTCAGCTCCCCAGAGGCACTGG + Intronic
1163609377 19:18293001-18293023 GTTCAGGGCCCCGGCGGGGAAGG - Intergenic
1164989133 19:32672141-32672163 GGTCAGAGCCCCGGAAGGGCGGG - Intronic
1166014884 19:39972187-39972209 GCTCAGGGCCCAGGAAGGACAGG - Exonic
927200348 2:20574543-20574565 TTTCAGAGCCCTGGAGGGCCAGG + Intronic
927210696 2:20637388-20637410 GGTCAGCGGCCCTGAGGGAGAGG - Intronic
929541998 2:42829798-42829820 GATCAGTGGCCAGGAGGGACAGG - Intergenic
931869774 2:66445450-66445472 GTTCAGCGCCCCGGAGGGACAGG - Intronic
937975220 2:127578121-127578143 GTGCAGTTCCCCTGAGGGACAGG - Exonic
937993752 2:127678513-127678535 GGTGAGCGTCCAGGAGGGACTGG + Intronic
942947105 2:181683542-181683564 CTGCAGCGCCCAGTAGGGACGGG - Intergenic
948122941 2:235544353-235544375 GTTCTGAGTCCCGCAGGGACTGG + Intronic
1168872808 20:1145535-1145557 GTGCAGAGCCCTGGAAGGACAGG + Intronic
1171432535 20:25092192-25092214 GTTCAGCTCCCTGTAGAGACAGG + Intergenic
1180137538 21:45871224-45871246 GTCCAGTGCCCGGGAGAGACAGG + Intronic
1180137554 21:45871270-45871292 GTCCAGTGCCCGGGAGAGACGGG + Intronic
1180204323 21:46248241-46248263 GTTCAGGGGCCCAGGGGGACTGG - Intronic
1183520544 22:38294070-38294092 GTTCTGAGGCCCAGAGGGACTGG + Intronic
954005906 3:47590481-47590503 CTTCAGCACCCCTGATGGACAGG - Intronic
960459252 3:117913337-117913359 GTTCATAGCCCTGGAGGGACTGG + Intergenic
961726641 3:128935078-128935100 GTCCTGCGCCCCGGCGGGAGGGG - Intronic
965404139 3:168249566-168249588 TTTAAGCGCTCCGGAGGGGCTGG + Intergenic
999736000 5:154513612-154513634 GTTCAGTGCCCAGGCAGGACTGG - Intergenic
1001396137 5:171420533-171420555 GCTCAGCGCCCAGGAGGGGTGGG - Intronic
1002591383 5:180293186-180293208 GCTCAGAGCCCCCTAGGGACTGG + Intergenic
1006310897 6:33258680-33258702 GTTCAGCGCCCCTGAGGAGCTGG + Intronic
1006837074 6:37005546-37005568 GGTCAGCCCCCCTGAGGGAGAGG + Intergenic
1008647316 6:53527844-53527866 GTGCAGCTCCCCTGGGGGACGGG - Intronic
1013180525 6:107713516-107713538 GATCAGAGCCCAGGAGGGACGGG - Intronic
1018708472 6:166479749-166479771 GTGCTTCTCCCCGGAGGGACGGG - Intronic
1019048887 6:169168230-169168252 GTTTAGGGCCCTGGGGGGACAGG - Intergenic
1019316154 7:387886-387908 GCTCAGCTCCCAGCAGGGACCGG + Intergenic
1019449075 7:1087119-1087141 GTTCAGCGGCCCCGAGAGTCCGG + Exonic
1029127703 7:98306159-98306181 GTTTAGCGACCAGGAGGGGCAGG + Intronic
1029842327 7:103378682-103378704 GTTCAGGGCCTCTGAGGGAAAGG - Intronic
1031451630 7:121927855-121927877 GTTCAGCCCCAAAGAGGGACTGG - Intronic
1032120135 7:129149617-129149639 ACTCAAAGCCCCGGAGGGACTGG - Intronic
1034976974 7:155454518-155454540 GTGAAGCGCCCCGGAGACACCGG - Intergenic
1050210812 9:3254003-3254025 GTTCAGGGCCCCAGAAGGAAAGG - Intronic
1053003642 9:34590940-34590962 GAGCAGCTCCCCGGAGGGGCAGG - Intergenic
1053153478 9:35757244-35757266 GGCCAGAGCCCCGGAGGGTCTGG + Exonic
1056532267 9:87498065-87498087 CGACAGCGCTCCGGAGGGACCGG + Exonic
1203760783 EBV:12370-12392 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203761712 EBV:15442-15464 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203762641 EBV:18514-18536 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203763570 EBV:21586-21608 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203764499 EBV:24658-24680 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203765428 EBV:27730-27752 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203766357 EBV:30802-30824 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1203767286 EBV:33874-33896 TCTCTGCCCCCCGGAGGGACCGG - Intergenic
1192229122 X:69252621-69252643 GTTCAAGGCCCTGGAGGGAAAGG + Intergenic
1199980336 X:152917238-152917260 GGTGAGCTCCCTGGAGGGACTGG - Intronic