ID: 931873924

View in Genome Browser
Species Human (GRCh38)
Location 2:66491467-66491489
Sequence TATTCCACCTTAATGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931873918_931873924 -3 Left 931873918 2:66491447-66491469 CCTATAGAAAATATGGTTCTTAT 0: 1
1: 0
2: 0
3: 12
4: 303
Right 931873924 2:66491467-66491489 TATTCCACCTTAATGGGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
931873917_931873924 2 Left 931873917 2:66491442-66491464 CCATTCCTATAGAAAATATGGTT 0: 1
1: 0
2: 1
3: 19
4: 266
Right 931873924 2:66491467-66491489 TATTCCACCTTAATGGGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931873924 Original CRISPR TATTCCACCTTAATGGGTGG GGG Intronic
900707622 1:4090352-4090374 GCTTCCACCCTGATGGGTGGTGG + Intergenic
910090563 1:83458302-83458324 TGTTCCACAATATTGGGTGGAGG - Intergenic
917672658 1:177287729-177287751 CATTGCACCTTAAGGAGTGGAGG - Intergenic
918125672 1:181581241-181581263 TATTCCTACTTAATTGGTGTGGG - Intronic
1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG + Intronic
1065554362 10:26900116-26900138 TGCTCCACCTTCATGGGTGAGGG - Intergenic
1067056032 10:43051283-43051305 TATTCCACCTTATTGGACAGAGG - Intergenic
1069168498 10:65194906-65194928 TATTCCCATTTAATGGGTGAGGG - Intergenic
1071805099 10:89110387-89110409 TATCCCACATTAATGTGTGTGGG - Intergenic
1072939702 10:99750090-99750112 TATACCATCTTAATAGGTGAAGG + Intronic
1076181264 10:128410622-128410644 GCTTCCACCTCAAGGGGTGGGGG + Intergenic
1078937150 11:15961976-15961998 TATTACAATTTAATGGGGGGAGG + Intergenic
1080839636 11:35971927-35971949 TATTCTATCTGAATGGATGGTGG + Intronic
1082223474 11:49671568-49671590 TAATCCACTTTACTGGGTGGGGG - Intergenic
1082630988 11:55541774-55541796 TATAAGACCTTGATGGGTGGAGG - Intergenic
1086625582 11:88947699-88947721 TAATCCACTTTACTGGGTTGGGG + Intronic
1087883493 11:103448073-103448095 TTTTCCACCTTATTGGATGCAGG + Intronic
1088055830 11:105576000-105576022 TATTCCATTTTTATAGGTGGGGG - Intergenic
1091007070 11:131962947-131962969 TATTTCACACTGATGGGTGGGGG - Intronic
1094538809 12:31345742-31345764 TATGCCATCTTAATTGGTGAAGG - Intergenic
1096224299 12:49855227-49855249 AATGTCACCTTAATGGGTGGAGG + Intergenic
1107496355 13:40929350-40929372 TATCCAACCTAAGTGGGTGGGGG + Intergenic
1108464411 13:50700489-50700511 AATTCCACCACCATGGGTGGTGG + Intronic
1110703622 13:78578993-78579015 TATTCTACGTTGTTGGGTGGTGG - Intergenic
1111202356 13:84955940-84955962 TATTCAAACTTAATGGGTTTAGG - Intergenic
1118867401 14:69714258-69714280 TCTTCCTGCTTCATGGGTGGTGG + Exonic
1120234859 14:81878491-81878513 TATACCATCTTAATAGGTGAAGG + Intergenic
1122792721 14:104191140-104191162 TTTTGCACTTTAAAGGGTGGAGG + Intergenic
1127947778 15:63772244-63772266 TATTGCTCCTTAATGGGAAGAGG - Intronic
1133941346 16:10311745-10311767 TAATCCATCTTAATAGGTGAAGG + Intergenic
1134362293 16:13542802-13542824 TATTCCACCATCAGGGATGGAGG + Intergenic
1139843997 16:69905924-69905946 GATTCCACCTTAAAGGATGAAGG + Intronic
1141472336 16:84247476-84247498 CATTCCACCTTCATGAGTTGGGG - Intergenic
1144018594 17:11220552-11220574 TATTCCACCTTAATTTGTGGTGG - Intergenic
1144280793 17:13724370-13724392 GTTACCATCTTAATGGGTGGAGG - Intergenic
1145325037 17:21815762-21815784 TATTCTAACTTGATGGCTGGTGG + Intergenic
1146561339 17:33872810-33872832 TATACAACCTTCCTGGGTGGCGG + Intronic
1153223438 18:2880904-2880926 AATTATACCTTAATTGGTGGAGG - Intronic
1164663255 19:29998425-29998447 TATTTCACCATAATAGCTGGAGG - Intronic
1164959608 19:32416523-32416545 TATTGAACCTGAGTGGGTGGTGG - Intronic
925109799 2:1323871-1323893 TGTCCCACATTACTGGGTGGCGG - Intronic
929539196 2:42806899-42806921 GATTCCATTTTAATGGGTAGCGG - Intergenic
930424352 2:51194247-51194269 CATTCCTCCTCACTGGGTGGTGG - Intergenic
930567048 2:53034048-53034070 TATAACATATTAATGGGTGGTGG + Intergenic
930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG + Intergenic
931847412 2:66218837-66218859 TATTCCACTATAATGGGACGGGG + Intergenic
931873924 2:66491467-66491489 TATTCCACCTTAATGGGTGGGGG + Intronic
933378060 2:81506408-81506430 TATACCACATTAATGTGGGGGGG - Intergenic
938899047 2:135783006-135783028 TATTCCTGCTTAGTGGGTGTGGG + Exonic
940427955 2:153552465-153552487 AATTCCACCTTAATGTGAGGAGG + Intergenic
940500972 2:154493375-154493397 TTTTCCACGTTCATGGGTAGGGG - Intergenic
943740736 2:191405405-191405427 TATTCCAGATTCATGGGAGGAGG - Intronic
943744944 2:191452384-191452406 TGTTCCACCTTAAGGGAAGGGGG + Intergenic
944290312 2:197997220-197997242 TCTTCCCCCTTAATGGGGCGGGG + Intronic
944452893 2:199860877-199860899 TTTTCCAGCTGCATGGGTGGGGG - Intergenic
948383821 2:237569104-237569126 AATACCACCATAATGGGGGGAGG + Intergenic
1169493236 20:6089120-6089142 TGTTCCACATTTCTGGGTGGTGG - Intronic
1173196127 20:40914062-40914084 TCTTCCACCTTGATGGTGGGAGG - Intergenic
1177108646 21:16995436-16995458 TATTACTCCTTCATGGCTGGAGG - Intergenic
1182018834 22:27063777-27063799 AATTTCTCCTTAATGGCTGGTGG + Intergenic
1184964907 22:47964521-47964543 AATTCTAGATTAATGGGTGGTGG + Intergenic
949329710 3:2908136-2908158 TAATACACCTTCATGAGTGGGGG - Intronic
950689521 3:14644593-14644615 TATTCAGCCTTAAAAGGTGGGGG + Intergenic
954882024 3:53843023-53843045 AATTCCACCTGTGTGGGTGGAGG + Intronic
955189274 3:56745147-56745169 ATTTCCACCATAATGGCTGGTGG - Intronic
955983356 3:64548985-64549007 TACTCCACCTGAATTGGCGGAGG - Intronic
969268867 4:6085361-6085383 AATGCCACCTAAATGGGTGGGGG + Intronic
971468870 4:26997502-26997524 GATTCCACCTGAGTGGGTGAGGG - Intronic
971841564 4:31858989-31859011 TATTCCACCTGCAGTGGTGGAGG + Intergenic
972171371 4:36349658-36349680 TATTCCAGCTTGATGAATGGTGG - Intergenic
972816319 4:42650425-42650447 TGTGCCAGCTAAATGGGTGGTGG - Intronic
975718644 4:77229240-77229262 TAATCTATGTTAATGGGTGGAGG - Intronic
978430889 4:108632061-108632083 TTTTCCTCCTTAATGGTAGGTGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
986779879 5:11055483-11055505 TATTCCAGCTTAATAGGGGAAGG - Intronic
987520645 5:18978869-18978891 TATTCCACCCTAAACGGTGAAGG - Intergenic
989341023 5:40375738-40375760 TATTCCACCTTGAGGTGTGGGGG + Intergenic
989772515 5:45161649-45161671 TGTTCCACCTTAATGAGAGTTGG - Intergenic
990181833 5:53169487-53169509 AATTCCATCTTACTGGATGGAGG - Intergenic
997819679 5:137053642-137053664 CAGTCATCCTTAATGGGTGGGGG + Intronic
999373864 5:151072774-151072796 TATACTACCTAAAAGGGTGGAGG - Intronic
999452573 5:151689381-151689403 TATTCCACTTTAGTGGTTTGAGG - Intergenic
1001921543 5:175604041-175604063 AATTCCATCTTGAAGGGTGGAGG - Intergenic
1007726665 6:43920970-43920992 AATTCCCCCATACTGGGTGGTGG + Intergenic
1008018047 6:46543113-46543135 TATTCCTCCTTCATGTTTGGAGG - Intergenic
1008611656 6:53189899-53189921 TATTCCACCTACATTAGTGGTGG - Intergenic
1014183227 6:118407685-118407707 CATTCCTCCTTACTGGGTGGGGG + Intergenic
1014539681 6:122660167-122660189 AAACCCACCTTAATTGGTGGGGG - Intronic
1016715441 6:147222495-147222517 TATTCCACCTAAAAGGGAGTGGG - Intronic
1016838317 6:148501739-148501761 CTTTCCTCCTGAATGGGTGGGGG - Intronic
1021494776 7:21261987-21262009 TATACCACCCTCATGGCTGGTGG + Intergenic
1024092364 7:45954662-45954684 TATTCCATCTTGACAGGTGGTGG - Intergenic
1024446941 7:49491756-49491778 TATGTCACCTTAATAGGTGAAGG + Intergenic
1029367699 7:100127241-100127263 GATACCAACTTAATGGGAGGCGG + Intronic
1029559683 7:101294362-101294384 TATTCTAACTTCATGGCTGGTGG + Intergenic
1033882272 7:145900795-145900817 TATTTCACCTTTATGTTTGGTGG + Intergenic
1039852283 8:41379489-41379511 TATTCCATCTTAATGAGAAGAGG + Intergenic
1041464411 8:58144376-58144398 CATTTCATCTTAATGGGAGGAGG + Intronic
1043014044 8:74916035-74916057 TATTTCATCATAATTGGTGGTGG + Intergenic
1046795341 8:118365393-118365415 AATTCCACCTACATGGGTGAGGG - Intronic
1053817564 9:41928623-41928645 TGTTCTACCTCAATGTGTGGGGG - Intronic
1054107819 9:61072295-61072317 TGTTCTACCTCAATGTGTGGAGG - Intergenic
1054613038 9:67258830-67258852 TGTTCTACCTCAATGTGTGGAGG + Intergenic
1057807914 9:98233803-98233825 TATTCCAGCTGCAGGGGTGGGGG - Intronic
1058344834 9:103948605-103948627 AATTCTACCTTAATGGGTTGGGG - Intergenic
1188931601 X:36118359-36118381 TATTCCATGTTCATGGGTTGGGG - Intronic
1192894765 X:75430593-75430615 TACTCCACCTTCAAGGATGGAGG + Intronic
1193228423 X:79013273-79013295 CATTCCAACTTCGTGGGTGGAGG - Intergenic
1194337101 X:92661171-92661193 TATTTCCTTTTAATGGGTGGAGG + Intergenic
1200645529 Y:5777910-5777932 TATTTCCTTTTAATGGGTGGAGG + Intergenic