ID: 931874300

View in Genome Browser
Species Human (GRCh38)
Location 2:66495636-66495658
Sequence TGCCATGCAAAACTGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931874300_931874306 5 Left 931874300 2:66495636-66495658 CCCTTTCCCAGTTTTGCATGGCA 0: 1
1: 0
2: 2
3: 27
4: 379
Right 931874306 2:66495664-66495686 GGAAAATGCAGGAAACGCTGAGG 0: 1
1: 0
2: 1
3: 30
4: 220
931874300_931874305 -6 Left 931874300 2:66495636-66495658 CCCTTTCCCAGTTTTGCATGGCA 0: 1
1: 0
2: 2
3: 27
4: 379
Right 931874305 2:66495653-66495675 ATGGCAGATGAGGAAAATGCAGG 0: 1
1: 0
2: 1
3: 41
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931874300 Original CRISPR TGCCATGCAAAACTGGGAAA GGG (reversed) Intronic
905850007 1:41266757-41266779 TCACTTGCAAAACTGGGAATTGG - Intergenic
906051047 1:42872744-42872766 TCCCATTAAAAAGTGGGAAAAGG - Intergenic
906494617 1:46295526-46295548 TGTCATGCAAAAGTGGGAAGCGG + Intronic
906875801 1:49537465-49537487 TTCCATTAAAAAGTGGGAAAGGG + Intronic
907552906 1:55319371-55319393 TTCCATGGATAACTGGGGAAGGG - Intergenic
909912634 1:81279613-81279635 GGCCATTCTAAATTGGGAAAAGG - Intergenic
911019237 1:93370383-93370405 TGCCAGGTAAAGATGGGAAAAGG - Intergenic
911545657 1:99213388-99213410 TGGGATGTAAAACTGGCAAAAGG + Intergenic
915764033 1:158344949-158344971 TCCCATCAAAAAGTGGGAAAAGG - Intergenic
916192423 1:162192331-162192353 TGTCCTGTTAAACTGGGAAAGGG + Intronic
916366241 1:164031169-164031191 TCCCATTAAAAACTGGGTAAAGG - Intergenic
916432377 1:164743462-164743484 TGCCATGCAAAAGTGAGCACTGG - Intronic
917622726 1:176813612-176813634 TGCTATTAAAAACTGGGCAAAGG - Intronic
917739095 1:177946015-177946037 ACCCAGGCAAAACTGGAAAATGG - Intronic
918002502 1:180510745-180510767 TCCCATCCAAAAGTGGGCAAAGG - Intergenic
918220033 1:182428296-182428318 TTCCATGCAAAAATGGGGACAGG + Intergenic
918441870 1:184575976-184575998 TGACAAGCAAAAATGGGAGACGG + Intronic
918853803 1:189724946-189724968 TGCCATCAAAAAGTGGGCAATGG - Intergenic
920951995 1:210581148-210581170 TCCCATCAAAAAGTGGGAAAAGG - Intronic
921736605 1:218635079-218635101 TTCCATCAAAAACTGGGCAAAGG + Intergenic
922578317 1:226678309-226678331 TGCCATGCAAACTTAGGAGAGGG + Intronic
1063184619 10:3639241-3639263 TGCCATTAAAAAGTGGGCAAAGG + Intergenic
1064043577 10:11990365-11990387 GCCCATGCAGAACAGGGAAACGG + Intronic
1065051865 10:21801303-21801325 TCCCATGAAAAAGTGGGCAAAGG + Intronic
1066012502 10:31207711-31207733 CCCCATGAAAAACTGGGCAAAGG + Intergenic
1068043449 10:51856420-51856442 TCCCATGCAAAATTAGCAAACGG - Intronic
1068491879 10:57734720-57734742 CCCCATCAAAAACTGGGAAAAGG - Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068646829 10:59477207-59477229 TAGCAGGCAAAACTGGGTAAGGG + Intergenic
1068785788 10:60971859-60971881 CCCCATCAAAAACTGGGAAAAGG + Intronic
1068894096 10:62180529-62180551 TGCCATGAAAAAATAGGATATGG - Intergenic
1070058142 10:72954768-72954790 TGTCAGGCAGGACTGGGAAAGGG + Exonic
1071313197 10:84363347-84363369 AGCCAGGAAAAAATGGGAAAAGG + Intronic
1071855032 10:89615465-89615487 TGCCAAGAAAAACTTTGAAATGG - Intronic
1072402408 10:95118506-95118528 ACCCATGCAAAAGTGGGCAAAGG - Intergenic
1072409980 10:95192771-95192793 TGCAATGAAAAGCTGAGAAAGGG + Intergenic
1073281511 10:102357838-102357860 TGCCATGCCAACCTGTGAAGTGG + Intronic
1073452745 10:103619294-103619316 TGCCATGCCTCACTGGAAAATGG - Intronic
1073895036 10:108145714-108145736 TGCCTTGCTAAACTGGGAGTGGG - Intergenic
1073999408 10:109354225-109354247 TGCCATTAAAAAATGGGCAAAGG - Intergenic
1074493282 10:113957738-113957760 TGATCAGCAAAACTGGGAAAAGG + Intergenic
1074525545 10:114260272-114260294 TACCTTGCAAAACTGGAGAAAGG - Intronic
1075782975 10:125028734-125028756 TGCAAAGCAGAACTGGGAAGCGG + Intronic
1077601229 11:3576313-3576335 TGCAGTGCATAAGTGGGAAATGG - Intergenic
1079313463 11:19387512-19387534 TGGCTAGCAAAACTGGGAAGGGG - Intronic
1079596245 11:22251721-22251743 TGCCATTCAAAACTGGGCAAGGG + Intronic
1080574169 11:33583287-33583309 TGACAAGCAACACTGGGAAGAGG - Intronic
1080607200 11:33873104-33873126 CCCCATGCAAAACTGTGACAAGG - Intronic
1081493004 11:43581566-43581588 TTCCGTGGAAAACGGGGAAAGGG - Intronic
1082126792 11:48441704-48441726 TCCCATTTAAAAGTGGGAAAAGG - Intergenic
1082250227 11:49970619-49970641 TCCCATTTAAAAGTGGGAAAAGG + Intergenic
1083125487 11:60561486-60561508 TCCCATTAAAAACTGGGCAAAGG - Intergenic
1083959014 11:66003607-66003629 AGGCCTGCAAAACAGGGAAAAGG - Exonic
1084095593 11:66909056-66909078 TGGAATGCCAAAGTGGGAAATGG + Intronic
1084815632 11:71644381-71644403 TGCAGTGCATAAGTGGGAAATGG + Intergenic
1085445864 11:76600185-76600207 TGCCAGGCAACAGTGAGAAACGG + Intergenic
1085817295 11:79752922-79752944 TTCCATTCAAAAATGGGAGAAGG + Intergenic
1087102204 11:94376574-94376596 TGCACAGCTAAACTGGGAAAAGG - Intergenic
1087416434 11:97862062-97862084 TGCCTTGCTTAACTGGGATAAGG - Intergenic
1087679604 11:101204686-101204708 TCCCATGAAAAAATGGGCAAAGG - Intergenic
1088525575 11:110749650-110749672 TCCCATCAAAAACTGGGCAAAGG - Intergenic
1088982616 11:114877039-114877061 TGCCAAGCAGATCTGAGAAATGG - Intergenic
1090083407 11:123629851-123629873 TTTCATGTTAAACTGGGAAAGGG + Exonic
1092953162 12:13526409-13526431 TGGAATGCAAGAGTGGGAAATGG + Intergenic
1093829160 12:23734528-23734550 TGCCATGGAAATCTTGCAAATGG - Intronic
1094227919 12:28067266-28067288 TGCCATGCCAGTCTGGAAAAGGG - Intergenic
1094365667 12:29677564-29677586 TGCCGTCCAAAAATAGGAAATGG + Intronic
1094569199 12:31627046-31627068 TGACAACTAAAACTGGGAAATGG - Intergenic
1094686324 12:32719537-32719559 TGGTATTAAAAACTGGGAAAAGG + Intronic
1095060892 12:37686924-37686946 TCCCATCAAAAACTGGGCAAAGG + Intergenic
1095999915 12:48120751-48120773 TGCCATACAAAAATGTGAGAAGG + Intronic
1096096419 12:48938517-48938539 TTCCATGTAAAACAGGGAGAGGG + Exonic
1097503783 12:60438832-60438854 TGCCAAGCAAAGTGGGGAAAAGG - Intergenic
1097530710 12:60796346-60796368 TTTCTTGCAAAACTGGGCAATGG + Intergenic
1098021785 12:66163519-66163541 TGCCAAGCAAAAGGGGGAAAGGG + Intronic
1098045525 12:66396653-66396675 GGAGATGCAAATCTGGGAAATGG + Intronic
1098926353 12:76354290-76354312 TGCCAAGAAAACATGGGAAATGG + Exonic
1099673535 12:85727050-85727072 TGTCATGAAAAATTGGGAATGGG + Intergenic
1100070732 12:90713579-90713601 TGCCATTCAAACCTAGGAATTGG - Intergenic
1101354479 12:103964438-103964460 TGCCATGCAAGATTGGGCAGAGG + Intronic
1106306056 13:28510836-28510858 TTTCATGCAAAACTGGGTGAGGG - Intergenic
1106958437 13:34970218-34970240 TGCCATTAAAAAATGGGCAAAGG - Intronic
1107089202 13:36458415-36458437 AGCCATACAAAAATGGGCAATGG + Intergenic
1108484851 13:50913112-50913134 TGCCTTGCTGAAATGGGAAATGG - Intronic
1108635546 13:52331220-52331242 TTCCATTTAAAAGTGGGAAAAGG + Intergenic
1108652259 13:52492021-52492043 TTCCATTTAAAAGTGGGAAAAGG - Intergenic
1109346672 13:61123499-61123521 TCCAATGCAAAAATGGGCAAAGG + Intergenic
1109427029 13:62178576-62178598 TCCCATTAAAAACTGGGCAAAGG + Intergenic
1110462512 13:75760568-75760590 TGCCGTGCAAAGCTGGAAAGAGG + Intronic
1110574525 13:77040427-77040449 TGACAAGCAAAAGTGGGAAAGGG - Intergenic
1111698031 13:91650039-91650061 TGCAATACAAAACTGGAACATGG + Intronic
1111738162 13:92168503-92168525 TGCCATTAAAAAGTGGGCAAAGG + Intronic
1114213430 14:20635950-20635972 TCCCATGAAAAAGTGGGCAAAGG + Intergenic
1115223070 14:31076485-31076507 TGCAATGTAAAAATGGGCAAAGG - Intronic
1115287947 14:31738007-31738029 TATCATGCAAAACTTGTAAAAGG - Intronic
1116887545 14:50235763-50235785 TGCTGAGCAAAAGTGGGAAAAGG + Intergenic
1116947672 14:50851015-50851037 TGCCTTTCAAAGCAGGGAAAGGG + Intergenic
1117583674 14:57178268-57178290 TGCCAACCAAAGCTGGCAAAGGG + Intergenic
1117888291 14:60388823-60388845 TGGAAAGCAAAACTGGAAAAGGG - Intergenic
1118326008 14:64781387-64781409 TGCCATTAAAAAGTGGGCAAAGG + Intronic
1119941577 14:78646949-78646971 TGCCAATCAAAACTAGCAAAAGG - Intronic
1121363650 14:93286707-93286729 TGACTTCCAAACCTGGGAAAAGG + Intronic
1124001251 15:25762123-25762145 TGCCGAGCAAAAGGGGGAAAAGG - Intronic
1124363050 15:29053104-29053126 TGGCAGGCCAAACTGGGAGAGGG - Intronic
1126924647 15:53570406-53570428 CGCCATTCAAAAGTGGGCAAAGG + Intronic
1127449660 15:59104267-59104289 TGCCATCAAAAAATGGGCAAAGG - Intergenic
1127998713 15:64171418-64171440 TGCCAGGCACACCTGGGATACGG + Exonic
1128363578 15:66980624-66980646 TGCCATTAAAAAGTGGGCAAAGG - Intergenic
1129651135 15:77490691-77490713 TGGCTTGGAAAACTGGGTAATGG + Intergenic
1130169436 15:81496610-81496632 TACCATGCCAATCTGTGAAATGG - Intergenic
1131664716 15:94557916-94557938 TACCATGAAAGACTGGGAGAAGG - Intergenic
1134129085 16:11636260-11636282 AGCCATGCAAAACTAGGATGCGG + Intronic
1134993473 16:18721257-18721279 TGCCATGCAAGACCAAGAAACGG - Intergenic
1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG + Intronic
1135587462 16:23681750-23681772 TGTCATGCAAAACAGGTCAAAGG - Intronic
1136678396 16:31937362-31937384 TGCCCTGCAAAAATGCTAAAAGG + Intergenic
1138162518 16:54767986-54768008 TGCCATCAAAAAGTGGGCAAAGG - Intergenic
1138748463 16:59390990-59391012 GGCCATGGAAAACTAGGACATGG + Intergenic
1139323188 16:66131891-66131913 TGTCGTGAAAAACTGAGAAAAGG - Intergenic
1143528644 17:7487426-7487448 AACCATGCAAGACTGGGAAAGGG - Intronic
1144238021 17:13281478-13281500 TGCTGTGCAGAACTGGGAAGTGG + Intergenic
1148014528 17:44511849-44511871 TGCCAGAAACAACTGGGAAAAGG - Intergenic
1148898217 17:50853299-50853321 TGCCAGGCACAATTAGGAAAGGG - Intergenic
1149397964 17:56264127-56264149 TGCCATGGAACTCTGGGAAAAGG + Intronic
1150231514 17:63554578-63554600 GGCAATACAAAACTGGGAAGTGG - Intronic
1150591620 17:66567600-66567622 TGACATCCCAGACTGGGAAAGGG - Intronic
1151161434 17:72168986-72169008 AGCCATGGAAACATGGGAAATGG + Intergenic
1151182309 17:72338194-72338216 GGCCATGCAAAAGTGGGCAGTGG - Intergenic
1151311221 17:73293496-73293518 TGCCAGGCAAAACCTGGGAAAGG - Intronic
1151423002 17:74010893-74010915 TCCCATCAAAAACTGGGCAAAGG + Intergenic
1153703349 18:7718727-7718749 TTCCATCAAAAACTGGGCAAAGG + Intronic
1153750146 18:8221218-8221240 TGCCAGGGAACACAGGGAAATGG - Intronic
1155276332 18:24191050-24191072 TACCTTGCAATACTGAGAAAGGG - Intronic
1155776993 18:29777216-29777238 TCCCATTAAAAACTGGGCAAAGG - Intergenic
1156257280 18:35410239-35410261 TGCCATGCAGAGGAGGGAAAAGG + Intergenic
1156422953 18:36975504-36975526 TCCCATCCAAAAAAGGGAAAAGG - Intronic
1156860027 18:41825194-41825216 TACCATCAAAAACTGGGCAAAGG - Intergenic
1156926827 18:42591754-42591776 TCCCATTTAAAAATGGGAAAGGG - Intergenic
1158752418 18:60278616-60278638 TGGCTTGCAAAATGGGGAAAGGG + Intergenic
1159528577 18:69626815-69626837 TGGCATGCAAAACTGGCAAGAGG + Intronic
1159543556 18:69812418-69812440 TGCCATGCAAAACTGAGGAATGG + Intronic
1159958470 18:74536960-74536982 TCCCATTAAAAACTGGGCAAAGG - Intronic
1160169433 18:76540723-76540745 TGACATGCAAACCAGGGCAAGGG - Intergenic
1160592884 18:79953580-79953602 AGCCATGCACAGCTGGAAAATGG + Intergenic
1160621049 18:80170887-80170909 TCCCCAGCAAAACTGGGGAAAGG - Exonic
1161288436 19:3480316-3480338 CGCCATGGAAAATTGGGAGATGG + Intronic
1162668403 19:12234897-12234919 AGCCATGGAAAACTAGGACATGG + Intronic
1166653399 19:44592369-44592391 GGCCATGGAGAACTGGGACACGG - Intergenic
1166885136 19:45956020-45956042 TGGCCTGCCAGACTGGGAAATGG - Intronic
1168440381 19:56361003-56361025 TGCCATTAAAAAATGGGCAAAGG + Intronic
925312286 2:2893703-2893725 TGCCAGGCAAAACTGGCATGGGG - Intergenic
925595185 2:5548691-5548713 TGCCATGGAATAGTCGGAAATGG + Intergenic
927286415 2:21361691-21361713 TTCCATGGCAAAGTGGGAAAAGG - Intergenic
927914971 2:26929781-26929803 TGCCATGCAAAACTGTGCACAGG - Intronic
928153125 2:28851176-28851198 TGCCTTGCAAAACAGAAAAATGG - Exonic
928363797 2:30686373-30686395 TGCCATCAAGAACTGGCAAATGG - Intergenic
929725899 2:44427468-44427490 TGCCATTGAAAAGTGGGCAAAGG + Intronic
930855427 2:56011401-56011423 TGGAATGCAAATCTGGGAAATGG - Intergenic
931202182 2:60108483-60108505 TCCAATTCAAAACTGGGCAAAGG - Intergenic
931458598 2:62431816-62431838 TGCCACCCAAACCTGGGCAAAGG - Intergenic
931874300 2:66495636-66495658 TGCCATGCAAAACTGGGAAAGGG - Intronic
932856232 2:75236750-75236772 TCCCATTGAAAACTGGGCAAAGG - Intergenic
933364188 2:81327913-81327935 AGCCATCCAAAATTGGGAAGAGG - Intergenic
934706207 2:96483294-96483316 TGCCAACAAAAGCTGGGAAAGGG - Intergenic
935060568 2:99603795-99603817 TCCCATTAAAAAGTGGGAAAAGG + Intronic
935371095 2:102347622-102347644 CTCCATGCAGGACTGGGAAAGGG - Intronic
935835099 2:107042316-107042338 TCCCATGAAAAAGTGGGCAAGGG + Intergenic
935864487 2:107370932-107370954 TGCCATTAAAAATTGGGCAAAGG - Intergenic
936285227 2:111176458-111176480 TGCCAGGGCAAACTGGCAAAGGG - Intergenic
936509368 2:113132887-113132909 TGCCATGCAAGAATGGGAACAGG - Exonic
936880295 2:117242408-117242430 GGCCATACAAAACAGGGAAGCGG - Intergenic
938674968 2:133623468-133623490 TCCCATCAAAAACTGGGATAAGG + Intergenic
938935246 2:136121874-136121896 TGCCATCCACCACTGGGAAAAGG - Intergenic
939614192 2:144344433-144344455 TGCAATGCAGAATTTGGAAATGG - Intergenic
940463336 2:153996502-153996524 TCCCATCCAAAAATGGGCAAAGG - Intronic
941023214 2:160432260-160432282 TACCATGGAGAACAGGGAAAAGG + Intronic
942353724 2:175083813-175083835 CCCCATCCAAAACTGGGCAAAGG + Intronic
945314640 2:208359330-208359352 TGCCATGCAGAAAAGGGAAGAGG + Intergenic
945553834 2:211254740-211254762 TCCCATGAAAAAGTGGGCAAAGG - Intergenic
945650113 2:212547235-212547257 TGCCATACCAAACTGGCAGAAGG - Intergenic
947099978 2:226609713-226609735 AGCCATCCAAGACTGGGACAAGG + Intergenic
947146710 2:227074218-227074240 TCCCATTAAAAAGTGGGAAAAGG + Intronic
947288701 2:228547061-228547083 TGGGTTGCAAAACTGGCAAAAGG - Intergenic
948037112 2:234866597-234866619 TGCCAAGCAAAAGGGGAAAAAGG + Intergenic
1169581076 20:7023612-7023634 AGCCAAGCAAAAGGGGGAAAAGG - Intergenic
1169945214 20:10980846-10980868 AGCCATGCAACACTGGGGAATGG - Intergenic
1170190927 20:13644363-13644385 TTCCATTAAAAACTGGGTAAAGG - Intergenic
1171111752 20:22490726-22490748 CCCCACGCAAAAATGGGAAAGGG - Intergenic
1171859742 20:30386511-30386533 TACAATTCAAAACTGGGCAAAGG - Intronic
1173373864 20:42464795-42464817 TGGCATGTAAAACCGGGAAAAGG - Intronic
1175039960 20:56039618-56039640 TTCCATGATAAACTTGGAAATGG + Intergenic
1177129064 21:17234381-17234403 TGACATGGAAAATGGGGAAAGGG + Intergenic
1178630585 21:34257160-34257182 TGCTAGACAAAACTGGGAAGAGG - Intergenic
1180678267 22:17603997-17604019 TACTATGGAAAACAGGGAAACGG + Intronic
1181893741 22:26087968-26087990 TGCAATGCAGAACTGAGAAGGGG + Intergenic
1182215566 22:28714459-28714481 TGCCATTTAAAAATGGGCAAAGG - Intronic
1182629068 22:31670618-31670640 TGGCAAGCAAAATTGAGAAATGG + Intergenic
1184218132 22:43080881-43080903 AGTCATGCAACACTGGGAACAGG - Intronic
951293477 3:20903115-20903137 TGCCATTCATTTCTGGGAAATGG - Intergenic
951298190 3:20965421-20965443 TGCCATTAAAAAATGGGCAAAGG - Intergenic
951821644 3:26820516-26820538 TACCATCAAAAAGTGGGAAAAGG - Intergenic
951900392 3:27652253-27652275 TCCCATTAAAAAGTGGGAAAAGG - Intergenic
952751111 3:36825714-36825736 TACCAAGCACAACTGGCAAAGGG - Intergenic
952847207 3:37698157-37698179 TGCCATCCAAAAGTGGGCAAAGG - Intronic
952984428 3:38765031-38765053 TCCCATCCAAAAGTGGGCAAAGG - Intronic
953019589 3:39105016-39105038 TGACATGCAATACTGGGGAGTGG - Intronic
954515203 3:51168905-51168927 TGCCATTAAAAACTGGGCAAAGG + Intronic
955686149 3:61550421-61550443 TCCCATGAAAAAGTGGGCAAAGG - Intergenic
955923944 3:63987519-63987541 TGCCATGCAAAAATAGAAAGTGG - Intronic
955971153 3:64439844-64439866 AGCCATACAAAACAGGAAAAGGG + Intronic
956167800 3:66409580-66409602 TGCGGTGCAAAACAGAGAAAGGG + Intronic
956301934 3:67781624-67781646 TTCCAGGCACAACTGGGATATGG + Intergenic
957072084 3:75575367-75575389 TGCAGTGCATAAGTGGGAAATGG - Intergenic
957872052 3:86101800-86101822 TGCCATTAAAAAGTGGGCAAAGG - Intergenic
958490182 3:94762716-94762738 TCCCATCCAAAAGTGGGATAAGG - Intergenic
958886391 3:99732474-99732496 TGCCAAGCAAAAGGGGGAAAAGG + Intronic
960750694 3:120949228-120949250 TCCCATGAAAAATTGGGCAAAGG - Intronic
960940741 3:122932165-122932187 TTCCATGCAAAACAAGCAAATGG - Intronic
962642050 3:137397828-137397850 TCCCATGAAAAAGTGGGCAAAGG + Intergenic
963393276 3:144697225-144697247 TGCCATTAAAAAATGGGCAAAGG - Intergenic
963562200 3:146880186-146880208 TGCCATTCACAACTGGTGAATGG + Intergenic
964017246 3:151962844-151962866 TAACATTAAAAACTGGGAAAGGG + Intergenic
964248800 3:154685739-154685761 TTCCTTGCAAAACAGAGAAAAGG - Intergenic
964488099 3:157206460-157206482 TGCCATGGAGAGATGGGAAAGGG + Intergenic
964695793 3:159506291-159506313 TCCCATCCAAAAGTGGGCAAAGG - Intronic
964742465 3:159981726-159981748 TTCAATTCAAAACTGGGCAAAGG - Intergenic
964882645 3:161441501-161441523 TGCCATCCAAAGGTGGGGAAAGG - Intergenic
964890934 3:161533565-161533587 TTCCATTCAAAGCAGGGAAAAGG + Intergenic
965791891 3:172397633-172397655 TGAAATGCAAAACTAGGAAAAGG + Exonic
966157925 3:176937214-176937236 TGCCATCAAAAAGTGGGCAAAGG - Intergenic
966306034 3:178535862-178535884 TGCCATGCACAACTGTCAAACGG - Intronic
966339685 3:178911840-178911862 TGCCATCAAAAAGTGGGCAAAGG + Intergenic
969015676 4:4102689-4102711 TGCAGTGCATAAGTGGGAAATGG - Intergenic
969687931 4:8686835-8686857 TGCCATGCAAAACCGAGAATTGG - Intergenic
969896149 4:10306823-10306845 TGCCACGGAAAAGTGGGGAATGG + Intergenic
972927852 4:44034056-44034078 TTCCATTCAAAACATGGAAATGG + Intergenic
973297132 4:48536621-48536643 AGCTATGCAGAACTGGAAAAAGG + Intronic
973302161 4:48598740-48598762 TGCAATGCAACAATGGGAAAAGG + Intronic
975158449 4:71097846-71097868 TCCCATGAAAAAGTGGGCAAAGG - Intergenic
975286243 4:72624438-72624460 TCCCATTAAAAACTGGGCAAAGG - Intergenic
975989770 4:80246709-80246731 TGCCTTGCACAACTTGGTAATGG + Intergenic
975998942 4:80348452-80348474 TCCCATTAAAAACTGGGCAAAGG + Intronic
977647618 4:99431639-99431661 CGCCATAAAAAACTGGGCAAAGG + Intronic
977825907 4:101531277-101531299 TCCCATCAAAAAGTGGGAAAAGG - Intronic
978838829 4:113185536-113185558 TGCCATCAAAAAGTGGGCAAAGG - Intronic
978932346 4:114330382-114330404 TGCCAGGCAAAACAGGAAACAGG + Intergenic
979988839 4:127349894-127349916 TCCCATTAAAAACTGGGCAAAGG + Intergenic
980243739 4:130210087-130210109 TGACATGCAAAAGTGAGATAAGG - Intergenic
980516992 4:133877063-133877085 TTCCCTGGAAAACTGGCAAAAGG - Intergenic
981076352 4:140596332-140596354 TTCCATCAAAAAGTGGGAAAAGG - Intergenic
982204689 4:152988925-152988947 TTCCAGGCAATATTGGGAAATGG + Intergenic
982703628 4:158684069-158684091 TGGGATGCAAAACTGGCAAGAGG + Intronic
984093107 4:175399849-175399871 TGGAATACAAAATTGGGAAAGGG + Intergenic
984851835 4:184161208-184161230 TCCCATGAAAAACTGGGCTAAGG + Intronic
987770385 5:22294868-22294890 TGCCATGTAAAGCTGGCAAGAGG - Intronic
987902378 5:24029511-24029533 TCCCATCAAAAAGTGGGAAAAGG - Intronic
988382246 5:30512805-30512827 TGACAAGAAAAACTTGGAAAAGG + Intergenic
989244609 5:39240488-39240510 TGCCATTAAAAAGTGGGCAAAGG + Intronic
990530141 5:56665415-56665437 ACCCATGAAAAAGTGGGAAAAGG - Intergenic
991442924 5:66669884-66669906 TGCCAGGAAAAAATGGGCAAAGG + Intronic
992342009 5:75833879-75833901 CACCATCAAAAACTGGGAAAAGG + Intergenic
993127096 5:83848972-83848994 TGCCAAGCAAAAGGGAGAAAAGG - Intergenic
993288643 5:86036040-86036062 TCCCATCAAAAAGTGGGAAAAGG + Intergenic
994224342 5:97235079-97235101 TGCCATCAAAAAGTGGGCAAAGG - Intergenic
995079934 5:108038086-108038108 TGACATGCAAAAATAGGGAACGG + Intronic
995102582 5:108331701-108331723 TTCCATTCCAAACTGGGAAATGG + Intronic
995176724 5:109186542-109186564 TGTCATGCCAGACAGGGAAAGGG - Intronic
995442512 5:112207591-112207613 TGCCATTAAAAAATGGGCAAAGG + Intronic
996402858 5:123082416-123082438 TGCCATCCAGAGCTAGGAAATGG + Intergenic
1000425498 5:161086024-161086046 TTACATGCAAAATTGAGAAAGGG - Intergenic
1000526714 5:162368196-162368218 TGCCAAGCAAAAGAGGGAAAAGG + Intergenic
1001860355 5:175048842-175048864 TCCCATCAAAAACTGGGCAAAGG + Intergenic
1002434646 5:179223128-179223150 TGCCACGCAAGGCTGGCAAATGG - Intronic
1004313923 6:14570176-14570198 GGCCAGGCAGAATTGGGAAAGGG - Intergenic
1005710473 6:28499450-28499472 TGCTTTGCAAATCTGGGAATAGG + Intergenic
1005919537 6:30387849-30387871 TCCCATCAAAAACTGGGCAAAGG + Intergenic
1006061152 6:31420350-31420372 CGCCATTCAAAAATGGGTAATGG - Intergenic
1006790418 6:36697700-36697722 TGCCAGGCAAAATTGTGAAAGGG + Intergenic
1008311456 6:49980097-49980119 TTCCATGCAAAACTGGGGATTGG - Intergenic
1009776476 6:68211716-68211738 GGCCATGTTAAACTTGGAAAGGG + Intergenic
1009781583 6:68278490-68278512 TTCCATGAAAAAGTGGGCAAAGG - Intergenic
1010065281 6:71675528-71675550 TGACTTGCAAAACTGGCAAGAGG - Intergenic
1013314470 6:108928155-108928177 TGCCGTGCAGAGCTGGGGAAGGG - Exonic
1013453863 6:110311865-110311887 TTCCATGAAAAAGTGGGCAAAGG - Intronic
1013693782 6:112676352-112676374 TACCATTCAAACCTGGGCAAAGG + Intergenic
1014411011 6:121120892-121120914 TCTAATGCAAACCTGGGAAAGGG - Intronic
1014871517 6:126602398-126602420 TGACATTTAAAACTGGGAGATGG - Intergenic
1015575100 6:134662899-134662921 TGCAATGTAAAACTTAGAAAAGG + Intergenic
1016424789 6:143923222-143923244 TCCCATGAAAAAGTGGGCAAAGG - Intronic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1017034663 6:150256304-150256326 TGCCATGCAATACAGAGCAATGG + Intergenic
1017573456 6:155774000-155774022 TGCCATCAAAAAGTGGGCAAAGG - Intergenic
1017821320 6:158050907-158050929 TGTCATGGAAAGGTGGGAAAGGG - Intronic
1018305895 6:162454843-162454865 TGCCTTGAACAACTGGGAACGGG + Intronic
1018912468 6:168110158-168110180 TGCCATGGCAGACTGGAAAAAGG - Intergenic
1019820891 7:3241935-3241957 TGCCATGCTGACCTGGGCAAGGG + Intergenic
1020042748 7:5016579-5016601 TGCCAGGGAAGACTGGCAAACGG - Intronic
1020289482 7:6711826-6711848 TGCCAGGGAAGACTGGCAAACGG - Intergenic
1021864047 7:24937149-24937171 TGCCGAGCAAAAGGGGGAAAAGG + Intronic
1022864458 7:34403048-34403070 AGACAAGCAAAACTGGAAAAAGG - Intergenic
1023376609 7:39562365-39562387 TGCCAAGCAAGAGGGGGAAAAGG + Intergenic
1023562253 7:41488476-41488498 TGCCATTCAAATCAGTGAAAGGG + Intergenic
1023826455 7:44013214-44013236 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1024098853 7:46008312-46008334 TCCCATGTAGAGCTGGGAAAAGG - Intergenic
1024117289 7:46206259-46206281 AGCCCTGGAACACTGGGAAAAGG - Intergenic
1024689873 7:51788405-51788427 TGCCATCAAAAAGTGGGCAAAGG + Intergenic
1024725316 7:52187873-52187895 TGTCACTCAAAAATGGGAAAAGG - Intergenic
1024741143 7:52355919-52355941 TTCCATGCAAAACTGGTCTAAGG + Intergenic
1024780085 7:52837550-52837572 TGCTATTCAAAACATGGAAATGG + Intergenic
1024947692 7:54827319-54827341 CCCCATGAAAAACTGGGCAAAGG + Intergenic
1026090033 7:67292084-67292106 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1026227248 7:68453194-68453216 GGCCATGCCACACTGGGAGATGG + Intergenic
1026746416 7:73016774-73016796 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1026750067 7:73044917-73044939 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1026753715 7:73073027-73073049 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1026757366 7:73101063-73101085 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1027032519 7:74901332-74901354 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1027090038 7:75292423-75292445 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1027093683 7:75320351-75320373 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1027097326 7:75348318-75348340 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1027119624 7:75507403-75507425 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1027272201 7:76528208-76528230 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1027322021 7:77019354-77019376 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1027325655 7:77047274-77047296 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1027623386 7:80520214-80520236 AGCCATGGCAAACTGAGAAAAGG + Intronic
1027938054 7:84634223-84634245 TCCCATGAAAAATTGGGCAAAGG - Intergenic
1029074342 7:97924322-97924344 TGCAGTGCATAAGTGGGAAATGG - Intergenic
1029398433 7:100325312-100325334 TGCCAGGGAAGACTGGTAAATGG + Intergenic
1029717872 7:102342628-102342650 TGCCAGGGAAGACTGGTAAATGG - Intergenic
1029754744 7:102566618-102566640 TGCCAGGGAAGACTGGTAAATGG + Exonic
1029772694 7:102665698-102665720 TGCCAGGGAAGACTGGTAAATGG + Intronic
1029875697 7:103749102-103749124 TGCCAAGCAAAGAAGGGAAATGG - Intronic
1030226321 7:107155699-107155721 TGCCATTAAAAAGTGGGCAAAGG - Intronic
1030229463 7:107191944-107191966 TACAAAGCAAAATTGGGAAAGGG + Intronic
1030962363 7:115942060-115942082 TGACATGCACAATTGTGAAAAGG - Intronic
1031141540 7:117948492-117948514 GGCCATGTAACACTGGCAAAAGG + Intergenic
1031540713 7:122991505-122991527 TGCCATCAAGAATTGGGAAAGGG - Intergenic
1034098376 7:148430264-148430286 TGCCATAAAAAAGTGGGCAAAGG + Intergenic
1034819288 7:154202153-154202175 TGCCATGGACATTTGGGAAATGG - Intronic
1035586770 8:781913-781935 TGCTATTCAAAACTGGGAGCTGG + Intergenic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1036829365 8:12010224-12010246 TGCAGTGCATAAGTGGGAAATGG - Intergenic
1037690136 8:21174648-21174670 TGCCTTGCAGAAGTGAGAAAAGG + Intergenic
1039342557 8:36667226-36667248 TGCCATCAAAAAGTGGGCAAAGG - Intergenic
1040078200 8:43261427-43261449 CCCCATGAAAAACTGGGCAAAGG - Intergenic
1043227751 8:77753207-77753229 TGTCATACAAAAATGGTAAAAGG + Intergenic
1045336391 8:101207017-101207039 TGCCACGCAAACTTGGGAAACGG - Intergenic
1045824587 8:106381896-106381918 TGGCATATAAAAGTGGGAAATGG + Intronic
1046216703 8:111157496-111157518 CGCCATTCAAAAGTGGGCAAAGG + Intergenic
1047191177 8:122680638-122680660 TGCAAAGGACAACTGGGAAATGG - Intergenic
1048439964 8:134452634-134452656 TGCCAGGCAGAACTAGGCAAAGG + Intergenic
1048780460 8:137993483-137993505 TGCCATTAAAAAGTGGGCAAAGG - Intergenic
1048930101 8:139308116-139308138 TGCCATGAAAGACTTGGAAATGG - Intergenic
1051294422 9:15580548-15580570 TCCCATCAAAAACTGGGCAAAGG + Intronic
1051363853 9:16306113-16306135 TGCCCTGCACAACTGGGGAGTGG - Intergenic
1051481907 9:17570653-17570675 TGCCATCAAAAAGTGGGTAAAGG - Intergenic
1051858269 9:21594745-21594767 TGCAATTCAAAAATGGGCAAAGG - Intergenic
1051886472 9:21898551-21898573 TGCCATCAAAAATTGGGCAAAGG + Intronic
1052333240 9:27293215-27293237 TGCCAAGGAAAGTTGGGAAAGGG + Intronic
1053184136 9:36000871-36000893 TGCCAAGAAAAAGGGGGAAAAGG + Intergenic
1053522853 9:38798555-38798577 TTCCATGAAAAAGTGGGCAAAGG - Intergenic
1053549713 9:39063315-39063337 TCCCATTAAAAACTGGGCAAAGG + Intergenic
1053813826 9:41883408-41883430 TCCCATTAAAAACTGGGCAAAGG + Intergenic
1054195077 9:62022975-62022997 TTCCATGAAAAAGTGGGCAAAGG - Intergenic
1054616770 9:67304032-67304054 TCCCATTAAAAACTGGGCAAAGG - Intergenic
1054643331 9:67565715-67565737 TTCCATGAAAAAGTGGGCAAAGG + Intergenic
1054933542 9:70662559-70662581 TCCCATGAAAAAGTGGGCAAAGG + Intronic
1055382741 9:75726594-75726616 AGCTATCCAAAACTGGAAAAGGG + Intergenic
1055584353 9:77742384-77742406 ACCCATGAAAAACTGAGAAATGG + Intronic
1056966510 9:91166897-91166919 TGCCCTCCATAAGTGGGAAATGG + Intergenic
1058719883 9:107754210-107754232 TGCCAAGCAAAAGGCGGAAAAGG - Intergenic
1058874658 9:109233468-109233490 TGCCCTGCAGAACTGAAAAAGGG - Intronic
1059652946 9:116332774-116332796 TGACATGTACAACGGGGAAATGG - Intronic
1059741439 9:117154289-117154311 TGTCATGTAGAAATGGGAAATGG - Intronic
1185928688 X:4175697-4175719 TGCCATTTAAAAATGGGCAAAGG + Intergenic
1186460890 X:9747940-9747962 TCCAATGGAAAACTGGAAAATGG - Intronic
1186551949 X:10515724-10515746 GGCCAAGAACAACTGGGAAAGGG - Intronic
1187577880 X:20577621-20577643 TGCCAAGCAAATGTGGGGAAAGG + Intergenic
1188056432 X:25546423-25546445 TGTCATTCAAATCTGGGAGAGGG - Intergenic
1189878667 X:45466006-45466028 TCCCATCAAAAACTGGGCAAAGG - Intergenic
1191679869 X:63830086-63830108 TGCCAAGCAAAAAGGGGAAAGGG - Intergenic
1192629650 X:72767360-72767382 TCCCATGAAAAAATGGGCAAAGG + Intergenic
1192652060 X:72953444-72953466 TCCCATGAAAAAATGGGCAAAGG - Intergenic
1192844860 X:74896039-74896061 TGCTATGGAAAAAGGGGAAACGG - Intronic
1193227710 X:79004574-79004596 GCCCATTCAAAACTAGGAAAAGG + Intergenic
1193702989 X:84786322-84786344 TCCCATCCAAAAGTGGGCAAAGG - Intergenic
1194037980 X:88902517-88902539 TCCCATGAAAAAGTGGGCAAAGG + Intergenic
1194190782 X:90834706-90834728 TCCCATCAAAAACTGGGCAAAGG - Intergenic
1194347049 X:92778692-92778714 TGCCATTAAAAACTGGTCAAAGG + Intergenic
1195124815 X:101797594-101797616 TCCCATTCAAAAATGGGCAAAGG + Intergenic
1195173193 X:102289035-102289057 TCCCATCCAAAAGTGGGCAAAGG - Intergenic
1195185673 X:102398061-102398083 TCCCATCCAAAAGTGGGCAAAGG + Intronic
1196531346 X:116790518-116790540 TCCCATCAAAAACTGGGCAAAGG + Intergenic
1196593821 X:117520172-117520194 TGCCATGGAACACTGTGAAAAGG - Intergenic
1197155035 X:123261321-123261343 TGTCATGCAAAGCTGAAAAAAGG + Intronic
1198274470 X:135088081-135088103 TGCTCTGCCAAACTGGGAGAGGG + Intergenic
1198314454 X:135452127-135452149 TGCTCTGCAGAACTGGGAGAGGG - Intergenic
1198668437 X:139050982-139051004 TGCCTGGCATAACTGGGGAATGG + Intronic
1198691151 X:139286234-139286256 TTAGAGGCAAAACTGGGAAATGG - Intergenic
1199289877 X:146093676-146093698 TGCCTTGTGAAACTGTGAAAAGG - Intergenic
1199995147 X:153019471-153019493 TGGCATGCAAACCTCAGAAAAGG + Intergenic
1200336744 X:155359034-155359056 TCCCATAAAAAAGTGGGAAAAGG + Intergenic
1200349726 X:155482193-155482215 TCCCATAAAAAAGTGGGAAAAGG - Intergenic
1200537437 Y:4417127-4417149 TCCCATCAAAAACTGGGCAAAGG - Intergenic
1201327978 Y:12786241-12786263 GACCATGCAAAACTTGGAGAAGG + Exonic
1201502789 Y:14663473-14663495 TGCCATGCAATATTTAGAAATGG - Intronic
1202065803 Y:20938622-20938644 TCCCATCAAAAAGTGGGAAAAGG - Intergenic
1202176102 Y:22100238-22100260 TGCCAGGCAAAAGTGAGATATGG + Intergenic
1202215259 Y:22486146-22486168 TGCCAGGCAAAAGTGAGATATGG - Intergenic