ID: 931875040

View in Genome Browser
Species Human (GRCh38)
Location 2:66503254-66503276
Sequence GGTTGTGGGTGTTCATCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931875040_931875048 22 Left 931875040 2:66503254-66503276 CCTAGGGATGAACACCCACAACC 0: 1
1: 1
2: 0
3: 8
4: 127
Right 931875048 2:66503299-66503321 TCATCTTGTTTTGCTTTCCCAGG 0: 1
1: 0
2: 2
3: 36
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931875040 Original CRISPR GGTTGTGGGTGTTCATCCCT AGG (reversed) Intronic
900153935 1:1196524-1196546 GGCTGTGGCTGTTCAGACCTGGG + Intronic
901858403 1:12058816-12058838 GCTTGTGGGTGTGCATTGCTGGG + Intergenic
902290431 1:15431464-15431486 GGATGTGGATGTTCCTCTCTTGG - Intergenic
903684103 1:25118725-25118747 TGTTGTGGGTGTTCAAACGTAGG + Intergenic
903838968 1:26225044-26225066 GGTGCTCGGTGTTCATCCATCGG + Intergenic
906546992 1:46626858-46626880 GATTCTGGGTGGCCATCCCTTGG - Intergenic
916096217 1:161353255-161353277 TGGTGTGGGTGGCCATCCCTGGG + Intronic
921604508 1:217138071-217138093 GGTTCTGGGTGTTCGTAACTAGG + Intergenic
922909438 1:229203439-229203461 GGTTGTGTGTATTCCACCCTGGG - Intergenic
1065631956 10:27689752-27689774 GGTTTGGGATGTACATCCCTGGG - Intronic
1066985759 10:42465242-42465264 GTGTGTGTGTGTTCATCACTTGG - Intergenic
1069709450 10:70479255-70479277 GGTTGTGTGTGTTGGACCCTGGG + Intronic
1070639650 10:78158503-78158525 GGTTGTGGGTGTCCATCCCTAGG + Intergenic
1073817770 10:107226045-107226067 GCTGGTGGGTGTGCATCCCATGG + Intergenic
1075953433 10:126501932-126501954 GTGTGTGTGTGTTTATCCCTAGG - Intronic
1081956784 11:47099480-47099502 GGTTGTGGGTGGGGGTCCCTAGG - Intronic
1084712838 11:70854738-70854760 AGCTGTGGGTGTTTCTCCCTGGG - Intronic
1088184313 11:107147797-107147819 GTTTGTGGGTGTTCATTTTTTGG - Intergenic
1089194989 11:116689100-116689122 GGCTGTGGATGCTCTTCCCTTGG - Intergenic
1090660496 11:128878684-128878706 GGTGGTGGGTGGTCCTCCCAGGG - Intergenic
1093760595 12:22904657-22904679 TGTTGTAGGTTTTCTTCCCTGGG - Intergenic
1096436357 12:51593186-51593208 GGTTGTGGGTAGTGATCCTTTGG + Intronic
1097741516 12:63248533-63248555 TGTTTTGGGTGGTGATCCCTAGG + Intergenic
1098851485 12:75601321-75601343 GGTGGTGGGTGGTCAGCACTGGG + Intergenic
1101845805 12:108362214-108362236 GGCTGTGTGTGTTCATCTGTGGG - Intergenic
1103935465 12:124474108-124474130 GGCTGTGGGTCTTCGTTCCTTGG - Intronic
1104892114 12:132145038-132145060 GGTTGGGGGCGCTCATCCCATGG - Intronic
1107657786 13:42609690-42609712 GGGTGTGTGTGGTCAGCCCTAGG + Intergenic
1114422289 14:22594444-22594466 GGTTGTCCTTGTTCATTCCTGGG - Intergenic
1114590568 14:23860903-23860925 GGTTGTGAGTTTTCATCCAGGGG - Intergenic
1115786876 14:36836575-36836597 GGATGTGAGTGTTGATCTCTGGG + Intronic
1122405184 14:101496567-101496589 GGTTGGGGGTGTTCATGACGGGG + Intergenic
1202847941 14_GL000009v2_random:199327-199349 TGTTGTGGGTATTCATGGCTAGG - Intergenic
1202917418 14_GL000194v1_random:189867-189889 TGTTGTGGGTATTCATGGCTAGG - Intergenic
1132085933 15:98908174-98908196 GCTTGTGGGGGGTCAACCCTGGG - Intronic
1133259557 16:4539218-4539240 GGTTGTCCTTGTTCATTCCTAGG + Intergenic
1135171403 16:20187163-20187185 GGTTTTTGGTGATCAACCCTAGG + Intergenic
1135232660 16:20724185-20724207 AGTTGTAGATATTCATCCCTGGG + Intronic
1138297649 16:55900593-55900615 GGCTGTGGGTCTTCAGCCCCTGG - Intronic
1138439294 16:57024621-57024643 GGTTGTTAGTGCTCACCCCTGGG + Intronic
1143045649 17:4076805-4076827 GGTTGGGGGTCTGCATCCCCAGG - Intronic
1144770563 17:17757202-17757224 GGTGTTGGGTGCTCAGCCCTGGG + Intronic
1146263925 17:31438612-31438634 TGATGTTGGTTTTCATCCCTTGG - Intronic
1149373269 17:56018077-56018099 GGTTGTGTGTGTCTATCTCTGGG + Intergenic
1149670474 17:58403759-58403781 GCTGGTGGGTGTTCACCCATGGG - Intronic
1151449242 17:74187566-74187588 GGTTGCAGGTGGTCAGCCCTAGG + Intergenic
1151947110 17:77325770-77325792 GTTTGGAGGTGGTCATCCCTGGG + Intronic
1153414898 18:4835870-4835892 TGTTGTGGGTGTTCATGCCCGGG - Intergenic
1156399385 18:36727074-36727096 GGTTCTGGGTGGTCAGGCCTAGG + Intronic
1157603345 18:48909237-48909259 CGTTGTGGTTTTTAATCCCTGGG - Intergenic
1158993042 18:62889669-62889691 GCTTGTGTGGGTTCTTCCCTGGG - Intronic
1160001349 18:75027296-75027318 AGCTGTGGGTTTTCATCCCTGGG + Intronic
1160623359 18:80186583-80186605 GGATGTGTGTGTGCATCCTTTGG - Intronic
1160714009 19:567099-567121 CGTGGTTGGTTTTCATCCCTCGG - Intergenic
1161949817 19:7461795-7461817 GGTTGTGGTGGTGCATGCCTGGG - Intronic
1162909279 19:13840679-13840701 GGGTGTGGGTGAGAATCCCTGGG - Intergenic
1163697397 19:18770850-18770872 GGGTGTGGGTGTGCATGCGTGGG + Intronic
1165262636 19:34634022-34634044 TGTTGTGGCTGTTCACCTCTAGG - Intronic
927709697 2:25316761-25316783 GGTGGTGGCTGTGCAGCCCTTGG - Intronic
929550801 2:42890385-42890407 AGTTGTCGTTGTTCATTCCTGGG + Intergenic
931875040 2:66503254-66503276 GGTTGTGGGTGTTCATCCCTAGG - Intronic
932341315 2:70964314-70964336 GGGTGTGGCTGTTGACCCCTCGG + Intronic
932495339 2:72143337-72143359 GAAAGTGGGTGTTTATCCCTTGG - Intronic
934809753 2:97268825-97268847 GGTTGGGGGGGTTCCTCACTGGG - Intergenic
934827942 2:97439160-97439182 GGTTGGGGGGGTTCCTCACTGGG + Intergenic
936444762 2:112586745-112586767 GGTTCTCTGTGTTCTTCCCTAGG + Intronic
936949641 2:117965201-117965223 GGGTGGGGGTGTTCCTCTCTTGG - Intronic
943234495 2:185300410-185300432 GGATGTGGGTGTGCCTCACTTGG - Intergenic
949038465 2:241832574-241832596 GGACGTGCGTGTTCCTCCCTTGG + Intergenic
1168910644 20:1444097-1444119 GGTTGTTGGTGTTTATCTCAAGG - Intronic
1170113265 20:12828150-12828172 GGATGTGGTTGTTCATCACTGGG - Intergenic
1178056356 21:28803268-28803290 GGATGTGTATGTTAATCCCTTGG - Intergenic
1178203515 21:30436614-30436636 GGCTGTGGCTCTCCATCCCTGGG - Intergenic
1178707523 21:34888212-34888234 GCTCGTGGGTGTTCGTGCCTCGG - Intronic
1180062643 21:45393616-45393638 GGTTGTGGGATTTGATCCTTAGG - Intergenic
1180926165 22:19556408-19556430 CGTTGTGTGTGTGCATCCCTGGG - Intergenic
1181099867 22:20531941-20531963 GGTAGTAGGTCATCATCCCTGGG + Intronic
1181111008 22:20602969-20602991 GGTTCTGGGTGCTCCTGCCTGGG - Intergenic
1184091449 22:42295063-42295085 GGCAGTGGGGGTTCATCACTGGG - Intronic
949723560 3:7018437-7018459 AGTTTTCTGTGTTCATCCCTAGG - Intronic
950884435 3:16350709-16350731 GGGTTTGGGTGTTGATTCCTGGG + Intronic
951790982 3:26484568-26484590 GGTTGGGGGTGTTCAACACTGGG + Intergenic
953381600 3:42476649-42476671 CGTGGTGGGTGTTCTGCCCTGGG - Intergenic
953757048 3:45655716-45655738 AGTTTTTGGTGTTTATCCCTCGG + Intronic
956774113 3:72550700-72550722 GGTTCTGGGTGAACATACCTTGG + Intergenic
960967509 3:123115411-123115433 GGCTGTGGGTCTTCACCACTAGG + Intronic
968809840 4:2794837-2794859 GCTTGTGTGCGTGCATCCCTGGG - Intronic
970254740 4:14155598-14155620 GGTTGTGAGGGCTCATGCCTAGG + Intergenic
973239483 4:47942114-47942136 AGTTGTGGTTATTGATCCCTCGG - Exonic
975712392 4:77173610-77173632 TGTTTTGGGTGTTGATCCCAAGG + Intronic
980963787 4:139501324-139501346 GGTTTTGGTTTTTCATTCCTTGG - Intronic
983781770 4:171677547-171677569 GGTTGTGGAAGTTCATACCAGGG - Intergenic
986315873 5:6586073-6586095 GGTAGTGGGTGTTCCGCCCCCGG + Intergenic
990792304 5:59495829-59495851 GGTTGTGGGGGTCGATCCCACGG + Intronic
993129664 5:83879604-83879626 GGGATTGGGTGTCCATCCCTTGG + Intergenic
996682391 5:126242231-126242253 GGTTATGGGTGTTCATGGCAGGG - Intergenic
997479968 5:134177429-134177451 GGGTGTGTGTGTTCATTCCTGGG + Intronic
999282217 5:150373495-150373517 GGCCCTGGGTGTTCAGCCCTGGG - Intronic
999638604 5:153648377-153648399 GCTTGTGGGAGATCATCTCTGGG + Intronic
1002189506 5:177471433-177471455 GGTTGGGGGAGTTCACTCCTAGG - Intronic
1004985359 6:21076214-21076236 TGCTGTGGGTGTTCATACCAAGG + Intronic
1006020678 6:31115993-31116015 TGTTGTGTGTGTGCATGCCTTGG - Exonic
1010209091 6:73348821-73348843 GGGTGTGGGTGTTCCTCGCAGGG - Intergenic
1013183832 6:107740297-107740319 GGATGTGGGTGGTCATCTGTTGG - Intronic
1015582470 6:134740867-134740889 GTCTGTGTGTGTCCATCCCTGGG - Intergenic
1016400581 6:143675799-143675821 AGTTCTGGGTGTTAATCCCATGG - Intronic
1016513983 6:144873425-144873447 GGCTGTCCTTGTTCATCCCTGGG + Intergenic
1017185785 6:151598903-151598925 ATGTGCGGGTGTTCATCCCTAGG + Intronic
1018253935 6:161899496-161899518 GGTGAAGGGTGTTCATCACTGGG + Intronic
1019391165 7:787430-787452 GGTTGGGGGAGTTCAGCCTTGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021063836 7:16147365-16147387 GATTTTGGGGGTTAATCCCTGGG - Intronic
1031406188 7:121390365-121390387 GGTTGTCCTTGTTCATTCCTGGG + Intronic
1033554605 7:142477737-142477759 GGGAGTGGGAGTTCATCCATGGG + Intergenic
1035021197 7:155801479-155801501 GGTTGTTGGTGGCCATCCCCAGG + Exonic
1036924107 8:12887458-12887480 AGTTGTGTGTGTTCTTCCCTTGG + Intergenic
1037329698 8:17732254-17732276 GGCTGTGTGTGTTTATTCCTCGG - Intronic
1041391497 8:57350951-57350973 GGATGTGGTTGTGTATCCCTTGG - Intergenic
1042356642 8:67835655-67835677 GCATGTGGGTCTTCATCTCTGGG - Intergenic
1044573804 8:93747460-93747482 GGCTGGGGGTGCTCATTCCTGGG - Intergenic
1049251644 8:141592360-141592382 GGGTGTGTGTGTTGTTCCCTCGG + Intergenic
1049646924 8:143739705-143739727 GGTTGTCCGTGTGCTTCCCTCGG + Intergenic
1050063777 9:1737640-1737662 GGTTGTGGGTTGGCTTCCCTGGG + Intergenic
1050874116 9:10613496-10613518 GGTAGTGGGTGTTAATAGCTGGG + Intergenic
1057757264 9:97848355-97848377 GATTGTGGGTGTTCATTTCTGGG - Intergenic
1058637408 9:107049826-107049848 GATAGTGGGTGTTTATTCCTAGG + Intergenic
1060277434 9:122192698-122192720 GGTTGTGTGGGGTCATACCTGGG - Intronic
1060937369 9:127523429-127523451 GGGTGTGGTTGTTGAGCCCTTGG - Intronic
1061862034 9:133473086-133473108 GGTGGTGAGTGTTCAGCCCCAGG - Exonic
1061920135 9:133778190-133778212 CTTTGTGGGCGTTCATCCCGGGG - Intronic
1190249841 X:48714394-48714416 CTTTGTGGGTGTATATCCCTTGG - Intergenic
1190251371 X:48729076-48729098 GACTGTGGGTGTACATCTCTGGG - Intergenic
1190251406 X:48729428-48729450 GCTTGTGAGTATTCATCCCAGGG - Intergenic
1196739335 X:119010790-119010812 GGTTGTGTGTGTGAATCTCTGGG + Intronic
1199118680 X:144024473-144024495 GGTTGTGTGTGTTTATTTCTGGG - Intergenic
1199284853 X:146044399-146044421 AGTTGTTGGTTCTCATCCCTTGG - Intergenic
1200830723 Y:7686735-7686757 GTGTGTGTGTGTTCATCCCCTGG - Intergenic