ID: 931880433

View in Genome Browser
Species Human (GRCh38)
Location 2:66564153-66564175
Sequence GTGGTCAAACAGCTCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931880433 Original CRISPR GTGGTCAAACAGCTCAGAAA AGG Intronic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
901625923 1:10625043-10625065 GTGGTCATACAGCTAACAAGTGG - Intronic
901685380 1:10940774-10940796 GTGGACCCACAGCTAAGAAATGG - Intergenic
901777458 1:11570105-11570127 AGGGTCACACAGCTCAGAGATGG - Intergenic
902886242 1:19406953-19406975 GTGGTCACACAGCTAAGACGTGG + Intronic
903465617 1:23550690-23550712 CTGGTCACACAGCTAAGAAGTGG + Intergenic
903774586 1:25784696-25784718 GAGGTCACACAGCCCAAAAAAGG + Exonic
904092233 1:27953480-27953502 AGGGTCATACAGCTTAGAAAAGG + Intronic
904107212 1:28095826-28095848 GTGGTCAAAAAACTTAGCAATGG + Intergenic
904261914 1:29292403-29292425 CAGGTCACACAGCTAAGAAAGGG - Intronic
904303564 1:29572041-29572063 ATGGCCACACAGCTCAGAAGTGG - Intergenic
904341030 1:29834730-29834752 AAGGTCACACAGCTCAGAAGTGG - Intergenic
904467397 1:30716517-30716539 GAGATCACACAGCTCAGAAGTGG + Intronic
904677874 1:32209375-32209397 CTGGTCAAACAGCCTAGCAAGGG + Intronic
904858687 1:33519173-33519195 AAGGTCACACAGCTCAGAAGGGG - Intronic
904890754 1:33777779-33777801 GGGATAAAACAGCTGAGAAAGGG - Intronic
904980326 1:34495646-34495668 GTGGACAACCAGTTCAGAAGTGG - Intergenic
906145281 1:43556993-43557015 GTGGGGAAACAGGTCAGAAGTGG - Intronic
906717859 1:47983720-47983742 GTGGTTACTGAGCTCAGAAAGGG - Intronic
907818432 1:57943095-57943117 GAGGTCACACAGCTAATAAAAGG + Intronic
908577507 1:65476445-65476467 GTGGTCCAATAGCTCAGTAAAGG + Intronic
908717871 1:67089227-67089249 GTAGTCTTACAGTTCAGAAACGG + Intergenic
909110200 1:71466049-71466071 GTGGTCACACATCTAGGAAATGG - Intronic
909926050 1:81439358-81439380 AAGGTCACACAGCTCAGAAGTGG - Intronic
910976327 1:92909998-92910020 GTGGTCAGGCAGCTAAGAGACGG + Intronic
912972729 1:114299257-114299279 CAGGGCAAACAGCACAGAAAGGG - Intergenic
916691190 1:167191428-167191450 GTGTGCAACCAGATCAGAAAGGG + Intergenic
917737585 1:177934661-177934683 CGGGTCACACAGCTCATAAATGG + Intronic
918102928 1:181392094-181392116 GTGGTAGATCAGCACAGAAAGGG + Intergenic
918902162 1:190436400-190436422 GTGGTCAACAATCTTAGAAAAGG + Intronic
1062818614 10:517897-517919 GTGGTGAAACTGCACAGAAGAGG - Intronic
1063210798 10:3879419-3879441 AAGGTCAAACAGCTTATAAAGGG - Intergenic
1063229533 10:4050663-4050685 GTGGTCACACAGCTAATAACTGG + Intergenic
1064309082 10:14195803-14195825 GCGTGCAAACAGCTCAGGAAAGG + Intronic
1064640477 10:17410535-17410557 ATGGTAAAACAGCACATAAAGGG - Intronic
1067286201 10:44909163-44909185 CTGGTCAAATAGCCCAGACAGGG - Intergenic
1068055614 10:52009504-52009526 CTGCTCAAACAAATCAGAAATGG + Intronic
1069590944 10:69641490-69641512 GTGGCCTCACAGCTCAGGAAGGG + Intergenic
1069715309 10:70517070-70517092 GTGGGTAAAGACCTCAGAAAAGG - Intronic
1069826588 10:71258506-71258528 CTGGCCACACAGCTCAGGAAGGG - Intronic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1072327243 10:94310656-94310678 GAGGTCACCCAGCTCAGAATTGG - Intronic
1074348209 10:112709248-112709270 GCTGACAAACACCTCAGAAAAGG + Intronic
1074943725 10:118260143-118260165 TTGGTCAAAACGGTCAGAAAAGG - Intergenic
1076184152 10:128433634-128433656 CTGGACACACAGCTCAGAAAAGG + Intergenic
1076509470 10:131002096-131002118 GGGGCCCAACAGCTCAGAACTGG + Intergenic
1076765000 10:132628265-132628287 GAGGTTACACAGCCCAGAAAGGG - Intronic
1077515753 11:3001205-3001227 GAGGGCAAAGAGCTCAGCAAAGG - Exonic
1077830247 11:5860355-5860377 GTGATAAAACATCTGAGAAATGG - Intronic
1081110894 11:39131799-39131821 GTGGTGACACAGCTGAGAAGTGG - Intergenic
1081131025 11:39380582-39380604 GTGGTCAATAAGCACATAAAAGG - Intergenic
1081797161 11:45828576-45828598 GTGGTCACACAGCTAGGAAGTGG - Intergenic
1085231674 11:74976937-74976959 GTGGTCAAAAAACTTAGCAATGG - Exonic
1089091819 11:115884555-115884577 GTGGTCGTACAGCTAATAAATGG + Intergenic
1090391446 11:126391386-126391408 GTGGTGGAACAGTTCTGAAAAGG + Intronic
1091649174 12:2296750-2296772 GTGGTCTAACAGTACGGAAATGG + Intronic
1091806541 12:3360938-3360960 GTGTTTAAAAGGCTCAGAAAGGG - Intergenic
1092282036 12:7105038-7105060 CTGGTCAACAAGCTGAGAAAAGG - Intronic
1094418173 12:30239725-30239747 GTGGGCAAAGAACTCAGAAAGGG + Intergenic
1095207176 12:39451520-39451542 AAGGACAAAGAGCTCAGAAAAGG - Intergenic
1097219345 12:57438149-57438171 TAGGTCAAACAGCTAATAAATGG - Intronic
1097373178 12:58809141-58809163 CTTGTCAAACTGCTCAGAATGGG - Intronic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1098227067 12:68335255-68335277 TTGGTCAGACCGCTGAGAAAGGG + Intergenic
1098441622 12:70525187-70525209 AAGGTCACACAGCTAAGAAATGG + Intronic
1100888167 12:99095444-99095466 GTGGCTAAACAGTTCAGAGAAGG + Intronic
1104063807 12:125289748-125289770 GAGGTCACACAGCTAAGAAGTGG + Intronic
1105205186 13:18217335-18217357 GTGGTCACACAGCTCAGGGCAGG + Intergenic
1108337327 13:49458396-49458418 GTGGTCACACAGTTAATAAATGG + Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110497008 13:76179975-76179997 GTGGTCAAACAGTTTAGTATTGG + Intergenic
1110601015 13:77373811-77373833 ATCAGCAAACAGCTCAGAAATGG + Intergenic
1112294398 13:98173907-98173929 TTGCTGAAACAGCTCAGAACAGG - Intronic
1114476964 14:23002492-23002514 ATGTTCACACAGCTCATAAATGG - Intronic
1115329737 14:32183562-32183584 GGGGTGTGACAGCTCAGAAAAGG + Intergenic
1116551762 14:46249228-46249250 AGGGTCAGACAGCTCAGAAAAGG - Intergenic
1117245912 14:53886551-53886573 GTGGCCAAAGTGCTCAAAAAGGG + Intergenic
1117788606 14:59314345-59314367 GTGATCAAACAGACCTGAAAAGG - Intronic
1118848561 14:69567091-69567113 GTGGTCATACAGCAGAGAAAAGG + Intergenic
1119054083 14:71400518-71400540 GTGGTCAAGCGGCACAGATAAGG + Intronic
1121422065 14:93823394-93823416 CAGGTCACACAGCTGAGAAAGGG + Intergenic
1121866766 14:97369071-97369093 ATGGTCACACAGCCCTGAAATGG + Intergenic
1122035767 14:98948265-98948287 AAGGTCACACAGCTCAGAAGTGG - Intergenic
1124230547 15:27942152-27942174 TAGGTCAAACAGCTAATAAATGG + Intronic
1125692340 15:41606359-41606381 AAGGTCAAACAGCTAATAAATGG - Intergenic
1125874411 15:43131584-43131606 GTGGTCAAAAAACTTAGCAATGG - Intronic
1127297839 15:57625460-57625482 ACTGTCAAACAGCTCAGAAGTGG - Intronic
1128190760 15:65693522-65693544 GTGTTCAAAGATCTGAGAAAAGG - Intronic
1129520677 15:76184049-76184071 CTGGGCTAGCAGCTCAGAAAAGG + Intronic
1130260955 15:82353936-82353958 GTGACCAAACACCTGAGAAAGGG - Intergenic
1130280280 15:82515080-82515102 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130471653 15:84231263-84231285 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130479147 15:84345834-84345856 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130492623 15:84442296-84442318 GTGACCAAACACCTGAGAAAGGG - Intergenic
1130593948 15:85235894-85235916 GTGACCAAACACCTGAGAAAGGG + Intergenic
1130613105 15:85379347-85379369 GTGACCAAACACCTGAGAAAGGG - Intergenic
1130701218 15:86184456-86184478 GAGGGCAAACAGCTTAAAAATGG + Intronic
1131178927 15:90227442-90227464 GTGGGGAATCAGCTCAGGAAAGG + Intronic
1131471632 15:92702679-92702701 CTGGTCAAACAGCTAAGAAGTGG + Intronic
1131864943 15:96698096-96698118 TTGGCCAACCAACTCAGAAAGGG - Intergenic
1132523186 16:400910-400932 GAGGCCAACCAGCGCAGAAAGGG + Intronic
1132632012 16:922472-922494 GTGGACAAACAGCTGAGAAAAGG + Intronic
1134777851 16:16868429-16868451 AAGGTCACACAGCTCAAAAAGGG - Intergenic
1134863407 16:17582293-17582315 GTGATCATACAGCTAACAAATGG + Intergenic
1137250159 16:46735572-46735594 GAGGTCCAGCAGCTCAGACACGG - Intronic
1141876134 16:86825794-86825816 AAGGTCACACAGCTCAAAAATGG - Intergenic
1144806229 17:17969925-17969947 GGGGTCACACAGCCAAGAAATGG + Intronic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1146007179 17:29168035-29168057 GTTGTCACACAGCTAATAAATGG + Intronic
1146246767 17:31292133-31292155 ATGGTCATACAGCTGAGAAGTGG + Intronic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146676325 17:34775992-34776014 AAGGTCACACAGCTCATAAATGG + Intergenic
1146917247 17:36686142-36686164 ATGGTCACACAGCTGCGAAAGGG - Intergenic
1147329249 17:39687156-39687178 GTGGTCAAACAGGCCAGAACTGG + Intronic
1147495893 17:40914943-40914965 GTGGTCATACAGCTATAAAATGG - Intergenic
1148214821 17:45828775-45828797 GTGGTGACTCAGTTCAGAAATGG + Intronic
1151003058 17:70400726-70400748 TTGGTCATACATCTGAGAAAAGG + Intergenic
1152835869 17:82530916-82530938 ATCCTCCAACAGCTCAGAAATGG - Intronic
1154005058 18:10520412-10520434 GTTGTCAAATGGCTGAGAAAGGG - Intergenic
1155853142 18:30797494-30797516 GAGGTCAAACAGCTAGTAAATGG - Intergenic
1157552353 18:48590423-48590445 GTGAGCAAACACCTCAGAATTGG + Intronic
1157864658 18:51170616-51170638 GTGGTCAAGGATTTCAGAAATGG - Intergenic
1158416521 18:57253751-57253773 GAGGTCAAACATCTAAGAAGTGG + Intergenic
1159027437 18:63197240-63197262 GTGGTCACACAGCTAGGAAGTGG - Intronic
1159454241 18:68640586-68640608 GTGGTCAAACAAGTCAAGAAAGG - Intergenic
1159461982 18:68733097-68733119 GAACTAAAACAGCTCAGAAATGG + Intronic
1160145008 18:76356672-76356694 GTTTTCAAACAGCTAAGGAAGGG + Intergenic
1163618488 19:18343492-18343514 GAGGTCACACAGCCAAGAAATGG + Intronic
1164880775 19:31731071-31731093 GTGGTCACACAGCTACCAAATGG - Intergenic
1165102301 19:33446153-33446175 GAGATCAAACAGATGAGAAATGG - Intronic
1167267259 19:48489761-48489783 CAGGTCACACAGCTAAGAAATGG + Intronic
1168347473 19:55657817-55657839 AAGGTCAAACAGCTAGGAAATGG - Intronic
925048239 2:790476-790498 GTGATAGAACAGCTCAGAGAAGG - Intergenic
925836496 2:7951674-7951696 GAGGTCACACAGCTAATAAATGG - Intergenic
928204897 2:29276877-29276899 GTGATGAAAATGCTCAGAAACGG + Intronic
928807916 2:35183832-35183854 TAGGTTAAACAGCTAAGAAATGG + Intergenic
930723082 2:54656715-54656737 GCCGTCAAACCTCTCAGAAAAGG - Intronic
931429972 2:62201294-62201316 GTGGCCAAACAACTCTGAATGGG - Intronic
931880433 2:66564153-66564175 GTGGTCAAACAGCTCAGAAAAGG + Intronic
933819584 2:86098574-86098596 GTGGTCACAGAAATCAGAAAAGG - Intronic
935451243 2:103211950-103211972 GAGGTCAAACAGTTCAGCACAGG - Intergenic
935795184 2:106634070-106634092 ATGGTCAAACATCTCTGGAAAGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
938084279 2:128388512-128388534 GTGGTCACACAGCTCAAAAGTGG + Intergenic
938806339 2:134809988-134810010 GTGGTCTAAGAGGACAGAAAAGG - Intergenic
940360850 2:152794059-152794081 GTAGTCAAACACTTCAGAAAGGG + Intergenic
941024784 2:160446723-160446745 GTGGACAAACAACAAAGAAAAGG - Intronic
941194454 2:162430795-162430817 CTTGTCAAGCAGGTCAGAAATGG + Intronic
941746500 2:169092520-169092542 GTAATCTAACAGCCCAGAAATGG + Intronic
942182601 2:173394831-173394853 GTTGTCAATCTCCTCAGAAAGGG - Intergenic
948503128 2:238409188-238409210 GTGAGCACACAGCTAAGAAAGGG + Intergenic
1168980642 20:2000811-2000833 GAGGTCATACAGCTCATAAATGG + Intergenic
1169510053 20:6254402-6254424 GAACTCAAACAGCTCAGAAAGGG - Intergenic
1170311000 20:14991227-14991249 GTGGTCAAACAGTTGGGAAATGG - Intronic
1170802675 20:19603298-19603320 GGGGTCAGACAGCTCAGCAGGGG + Intronic
1170972578 20:21129927-21129949 CTTCTCAAACAGATCAGAAAAGG - Intronic
1171116727 20:22531355-22531377 GATGTCACCCAGCTCAGAAACGG + Intergenic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1172588833 20:36103473-36103495 AAGGTCACACAGCCCAGAAATGG - Intronic
1172787696 20:37480047-37480069 GTGTTGAAGCAGCTCAGAGATGG - Intergenic
1172984286 20:38970575-38970597 GAGGTCACACAGCACACAAATGG - Intronic
1173334236 20:42100018-42100040 AAGGTCAAGTAGCTCAGAAATGG - Intronic
1174187736 20:48719135-48719157 TTGGTCACACAGCTAAGAAGTGG + Intronic
1174288075 20:49485989-49486011 CTGGTCTACAAGCTCAGAAAGGG - Intergenic
1177119318 21:17122289-17122311 GTGGTCGGACACCTCTGAAATGG - Intergenic
1177510662 21:22082961-22082983 GTAATCAAACAGCTTAGGAATGG - Intergenic
1178665497 21:34542949-34542971 AAGGTCACACAGCTAAGAAATGG - Intronic
1178746283 21:35253409-35253431 AAGGTCATACAGCTCAGATATGG - Intronic
1179052412 21:37899122-37899144 GGGGCAAAACAGCTAAGAAAGGG + Intronic
1180764081 22:18233594-18233616 GTGGTCACACAGCTCAGGGCAGG - Intergenic
1180771562 22:18390947-18390969 GTGGTCACACAGCTCAGGGCAGG + Intergenic
1180802940 22:18640562-18640584 GTGGTCACACAGCTCAGGTCAGG + Intergenic
1180829048 22:18888649-18888671 GTGGTCACACAGCTCAGGGCAGG - Intergenic
1181218775 22:21354699-21354721 GTGGTCACACAGCTCAGGGCAGG - Intergenic
1182065456 22:27428376-27428398 GTGGTTAATCAGCTCAGAGGAGG - Intergenic
1183316596 22:37140516-37140538 GAGGTCACACAGCTAAGAAATGG + Intronic
1203233400 22_KI270731v1_random:131938-131960 GTGGTCACACAGCTCAGGGCAGG + Intergenic
1203279139 22_KI270734v1_random:114636-114658 GTGGTCACACAGCTCAGGGCAGG - Intergenic
949347201 3:3087563-3087585 GTTGTCAAACAGCCAAGAAGTGG - Intronic
949977146 3:9471324-9471346 GTGGTCACACAGCTAGTAAATGG + Intronic
952163657 3:30722044-30722066 GTGGTCATGGAGATCAGAAAAGG + Intergenic
953616784 3:44497729-44497751 GCAGTCAAATAGTTCAGAAATGG + Intergenic
954899270 3:54005274-54005296 GAGGTCAAATAGCTCATAAGTGG + Intergenic
957261340 3:77905838-77905860 GAGCTCACACAGCTCAGAAATGG + Intergenic
958139827 3:89548105-89548127 GAGGTCATACATCTGAGAAATGG - Intergenic
958963383 3:100532761-100532783 CAGGTCAAACAGCTTACAAATGG - Intronic
959015455 3:101129168-101129190 TTAGTGAAACAGCTCAGAAGTGG - Intergenic
960170859 3:114459415-114459437 GGGGTCAAACAGGTGGGAAAGGG - Intronic
961268385 3:125667626-125667648 GGGCTCAAAGGGCTCAGAAATGG + Intergenic
961626468 3:128267244-128267266 GTGGCCAAAAAGCTCAGAACAGG - Intronic
961642437 3:128373137-128373159 GAGGTCGCACAGCTGAGAAAGGG + Intronic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
963251716 3:143109998-143110020 GTGGTACAAGAGCTCAGGAATGG + Intergenic
964416654 3:156454799-156454821 TTGGCCAATCTGCTCAGAAAGGG - Intronic
964578831 3:158207065-158207087 GTGGTCATAGAGCTAATAAACGG + Intronic
964985997 3:162739963-162739985 GTGGTCACATAGCTCATAAATGG + Intergenic
965073346 3:163944036-163944058 CTGGGAAAAAAGCTCAGAAAAGG - Intergenic
965866019 3:173204661-173204683 GTGGTCAAATAGGACAGCAAGGG - Intergenic
966778821 3:183566022-183566044 GTGGTCAAAGAGGTCAGTGAAGG + Intergenic
968079487 3:195836169-195836191 GGGGTCAACCATCTCAGCAATGG - Intergenic
970324809 4:14912631-14912653 GAGGTCAGACAGCTAAGAAATGG + Intergenic
970853114 4:20625469-20625491 CTGGTCTAACAGTTCAGTAAAGG + Intergenic
976050574 4:81007991-81008013 AAGGTCAAACAGCTAATAAATGG - Intergenic
976129318 4:81867858-81867880 GTGTTCAGGCAGCTCTGAAAGGG - Intronic
976831588 4:89320984-89321006 GTGGGCGAAAAGCTCGGAAATGG + Intergenic
981031775 4:140132554-140132576 GTGTTCAAACAGCCCTGACATGG - Intronic
981079625 4:140626069-140626091 GTAGACATACATCTCAGAAAGGG - Intronic
981318834 4:143368250-143368272 GTGGTCAAAGATCAGAGAAAGGG + Intronic
982355300 4:154460420-154460442 GAGGTCAAACAGATCATACATGG - Intronic
986433062 5:7700829-7700851 TTTGTCAGACAGATCAGAAATGG + Intronic
986565659 5:9111194-9111216 CTGGTGAATCAGCTTAGAAATGG - Intronic
987189985 5:15467240-15467262 TAAGTTAAACAGCTCAGAAACGG + Intergenic
987324450 5:16799872-16799894 ATGGTCACGCAGCTCACAAAAGG + Intronic
988818455 5:34857182-34857204 GTGATCCAGCAGCTGAGAAAGGG + Intronic
990218502 5:53561118-53561140 GTGGGCAAACAGGTGACAAATGG - Intronic
992498737 5:77321088-77321110 GATGTCAAACGGCTCAGAGATGG - Intronic
992606215 5:78459005-78459027 GAGGTCACACAGCTTATAAATGG - Intronic
993384739 5:87251275-87251297 GTGTTAAAACAGCTCAGAGGAGG + Intergenic
994340395 5:98620213-98620235 ATGGTCTAACAACTCACAAAAGG + Intergenic
995611108 5:113911173-113911195 GTGGAGAGAGAGCTCAGAAAAGG + Intergenic
996168178 5:120252334-120252356 TTTGTCAAACAGCTAATAAATGG + Intergenic
1001571243 5:172732085-172732107 GGGGCCACACAGCTCAGAAGTGG + Intergenic
1002185517 5:177453049-177453071 CAGGTCACACAGCTCAGAAGGGG - Intronic
1003398837 6:5775237-5775259 GTGGTCAGGCAGCCAAGAAATGG + Intergenic
1004058173 6:12162283-12162305 GTGGAGAAACTGCTCAGAAGGGG - Intronic
1010627755 6:78159333-78159355 GAGGCCACACAGCCCAGAAATGG - Intergenic
1011986538 6:93454209-93454231 GTGGTTAAAGACCTCAGAACTGG - Intergenic
1016887024 6:148968087-148968109 GTGGGCAAACAGCACCGAAGTGG - Intronic
1017153666 6:151303955-151303977 CAGGTCACACAGCTCAGGAATGG - Intronic
1019726158 7:2603745-2603767 GTGGGAAAAGAGCTCAGCAAAGG - Intronic
1020100396 7:5391109-5391131 GGGGTCACACAGCAGAGAAAGGG - Intronic
1020225548 7:6276929-6276951 GTGGTCAAAAGGCTGATAAATGG - Intergenic
1020459119 7:8408313-8408335 GTGCTTGAACATCTCAGAAAAGG + Intergenic
1020879983 7:13749235-13749257 GAGGTTAAAGAGCCCAGAAACGG - Intergenic
1021050220 7:15973885-15973907 GTGGTCCCACAGCTAGGAAATGG + Intergenic
1021636798 7:22701909-22701931 GAGGTCACACAGCTAATAAATGG + Intergenic
1021835165 7:24664677-24664699 GTGTTGAGACAGCTAAGAAATGG + Intronic
1021865592 7:24953604-24953626 GTGATCAAACAGTTCAGACAGGG + Intronic
1023870336 7:44259965-44259987 ATAGTCACACAGCTCACAAAAGG + Intronic
1024137411 7:46424826-46424848 GAGGTTAAACTGCTAAGAAAAGG - Intergenic
1027701561 7:81476323-81476345 GAGGGCAGACACCTCAGAAATGG - Intergenic
1028050936 7:86185289-86185311 GTGGTCAAAGAACAGAGAAAAGG - Intergenic
1030488287 7:110199482-110199504 GTGGTACAACAACTCACAAATGG - Intergenic
1034527314 7:151673483-151673505 GGGGCAAAACAGCTCAGTAAAGG - Intronic
1034529899 7:151689264-151689286 GAGGATAAACAGCTCAGGAATGG - Intronic
1035140390 7:156753585-156753607 GTGGAAAATCAGGTCAGAAATGG + Intronic
1035989353 8:4470597-4470619 CTGGTCTAAGAGCTCATAAATGG + Intronic
1038781645 8:30573263-30573285 TTGGCCAAACAGCTAAGGAATGG + Intergenic
1041497575 8:58503637-58503659 GTCTGCAAACAGCTCAAAAAAGG - Intergenic
1041886115 8:62809810-62809832 TTGATCACACAGCTGAGAAACGG + Intronic
1041954549 8:63543060-63543082 GTGGTTAAACTGTTAAGAAAAGG + Intergenic
1042455413 8:68996538-68996560 GTGCCCAAACAGCTAATAAATGG + Intergenic
1044011446 8:86998976-86998998 GTGGGCAAAAAGGTCAAAAATGG - Intronic
1047118021 8:121867184-121867206 GTTGACAAACACCACAGAAAAGG - Intergenic
1048106272 8:131413682-131413704 GTGTTCCAACAGCACACAAAAGG + Intergenic
1049934531 9:488512-488534 GAGTTCAAACAACTCATAAACGG - Intronic
1051741598 9:20257921-20257943 GTGTGTAAACAGCTAAGAAAAGG + Intergenic
1051854941 9:21553570-21553592 GGGGTCAGACAGCTAATAAATGG - Intergenic
1052977365 9:34421174-34421196 GGGGTCAAGCAGGTCAGAGAGGG + Intronic
1053158723 9:35798759-35798781 GAGGTCCAGCAGCTCAGGAAGGG + Intronic
1056557719 9:87703614-87703636 GTGGGAAAACAGTTGAGAAAAGG + Intronic
1057998813 9:99844812-99844834 GAGGACAAACAGCTCCAAAAAGG - Exonic
1058605271 9:106715002-106715024 AAGGTCAGACAGCTAAGAAATGG + Intergenic
1059392730 9:114009117-114009139 GTGGGCACACAGCTGAGAACAGG + Intronic
1059433174 9:114261806-114261828 ATGGTCACACAGCTAGGAAATGG - Intronic
1060081647 9:120652944-120652966 GAGGTCAAACAGCTTAATAAAGG + Intronic
1060842939 9:126809203-126809225 GTGGTTACACGTCTCAGAAATGG - Intronic
1061379251 9:130244220-130244242 GGGGTCACACAGCTGATAAATGG + Intergenic
1185789924 X:2920988-2921010 GTGGTGTCACAGCTCAGAAAGGG + Intronic
1188629734 X:32339586-32339608 GTAGTAATAAAGCTCAGAAAAGG - Intronic
1190619300 X:52269461-52269483 GAGGTGGATCAGCTCAGAAAAGG + Intergenic
1192985927 X:76398301-76398323 GTTGTCAAAAATCCCAGAAATGG - Intergenic
1193136350 X:77975207-77975229 GTGGCCAAAAGGCTTAGAAATGG - Intronic
1195355637 X:104037347-104037369 GTGATCACACAGCTGATAAATGG - Intergenic
1198994123 X:142554263-142554285 ATGGTCACACAGCTCAGTAGAGG - Intergenic
1199856285 X:151761648-151761670 GTGGCCAAATAGCTTTGAAAAGG + Intergenic
1201012730 Y:9564351-9564373 GTGCTCTAAAAGCTGAGAAAAGG + Intergenic