ID: 931881215

View in Genome Browser
Species Human (GRCh38)
Location 2:66573485-66573507
Sequence ATTGCTAAGGGCCGGTTTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931881215_931881221 17 Left 931881215 2:66573485-66573507 CCTATAAACCGGCCCTTAGCAAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 931881221 2:66573525-66573547 AAGAGAAACCAGCTGTGGGTTGG 0: 1
1: 0
2: 3
3: 32
4: 345
931881215_931881219 12 Left 931881215 2:66573485-66573507 CCTATAAACCGGCCCTTAGCAAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 931881219 2:66573520-66573542 TCGAAAAGAGAAACCAGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 198
931881215_931881220 13 Left 931881215 2:66573485-66573507 CCTATAAACCGGCCCTTAGCAAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 931881220 2:66573521-66573543 CGAAAAGAGAAACCAGCTGTGGG 0: 1
1: 0
2: 0
3: 13
4: 173
931881215_931881223 27 Left 931881215 2:66573485-66573507 CCTATAAACCGGCCCTTAGCAAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 931881223 2:66573535-66573557 AGCTGTGGGTTGGCTTTACTAGG 0: 1
1: 1
2: 3
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931881215 Original CRISPR ATTGCTAAGGGCCGGTTTAT AGG (reversed) Exonic
906711538 1:47933986-47934008 ATGGCTAAGGGTTGTTTTATTGG + Intronic
906885885 1:49647931-49647953 ATTACTAAAGGCCTATTTATAGG + Intronic
908339585 1:63162843-63162865 ATTGCTAAGGGCCTGTGCTTTGG - Intergenic
923799662 1:237195253-237195275 ATTGCTAAGTGCCGAGATATTGG - Intronic
1069204635 10:65666540-65666562 ATTGTTAAGTGCCAGTTTTTAGG + Intergenic
1096546045 12:52340939-52340961 AATGGCAAGGGCAGGTTTATTGG + Intergenic
1098361248 12:69656463-69656485 ATTGTTAAGGGGGGTTTTATGGG - Intronic
1099873606 12:88377694-88377716 ATTGCTGAGGGTAGGATTATGGG - Intergenic
1100760488 12:97801502-97801524 ATTGCTTGGGGCCAGTTTAGGGG + Intergenic
1103021437 12:117537942-117537964 ATGGGGAAGGGCCGTTTTATGGG - Intronic
1116552731 14:46263006-46263028 AGTTCTCAGGGCCTGTTTATTGG + Intergenic
1117211491 14:53505393-53505415 ACTGCTAAGGCCAGGTTTACAGG + Intergenic
1120297131 14:82656182-82656204 ATTGCAAAGGTCAGCTTTATAGG + Intergenic
1122239517 14:100353232-100353254 AATGCTATGAGCTGGTTTATTGG - Intronic
1123173624 14:106397778-106397800 ATTTCTTAGGGACGGTTTAAGGG - Intergenic
1124718953 15:32095149-32095171 ATTGCTCAGGGTCTGTTTGTTGG - Intronic
1127444381 15:59045600-59045622 ATTGGTAATGCCCAGTTTATGGG + Intronic
1133043866 16:3075534-3075556 ACTGCTCAGGGCAGGTTCATAGG - Intronic
1133558645 16:6929255-6929277 ATTGCTAAGGGTTGGATTAGAGG + Intronic
1143883559 17:10049304-10049326 ATTGCCATGGGGTGGTTTATTGG - Intronic
1158484786 18:57856749-57856771 ATTGCTAATGGCCAGTATATTGG + Intergenic
1159453385 18:68631018-68631040 ATTGCTAAGGACCAGTTTCATGG - Intergenic
930309382 2:49719091-49719113 ATTGCTAAGGTCTGGTTTTATGG + Intergenic
931881215 2:66573485-66573507 ATTGCTAAGGGCCGGTTTATAGG - Exonic
932472214 2:71967276-71967298 ATTTCTAAGGGAGAGTTTATAGG + Intergenic
942885863 2:180922925-180922947 ATTGTTAACTGCCTGTTTATAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1169384955 20:5140848-5140870 AGTTCTAAGTGCTGGTTTATAGG + Intronic
1175024958 20:55891978-55892000 ATTGCTAGGAGCTGGATTATAGG + Intergenic
949324077 3:2843979-2844001 ATGGCCAGGGGCCAGTTTATGGG - Intronic
949845497 3:8366330-8366352 ATTCCTAAGGGCCTGTCTATGGG - Intergenic
950586448 3:13895631-13895653 ATTGCTGAGGGCTGGTCTGTCGG + Intergenic
952570854 3:34713966-34713988 AATGCTAAGGGTGGGTTTACAGG + Intergenic
959668398 3:108946637-108946659 ATAGCTAAATACCGGTTTATAGG + Intronic
962555011 3:136539748-136539770 ACTGCTATGTGCAGGTTTATAGG + Intronic
973654951 4:53036930-53036952 ATTGCCAAGGGCTGGTTTGGGGG + Intronic
989218653 5:38930548-38930570 ATTGCTCAGGGAGGGTTTAGGGG - Intronic
999935738 5:156484022-156484044 ATTAGAAAGGGCCGGTTTCTGGG - Intronic
1004885219 6:20044590-20044612 ATTGCCATGAGCCTGTTTATAGG - Intergenic
1013594962 6:111652088-111652110 ATTGCTGAGGGGCAGTTTCTAGG - Intergenic
1016049003 6:139510305-139510327 TTTACTAAGGGCCAGTTAATGGG - Intergenic
1021189090 7:17600010-17600032 ATAGCTAATGGACAGTTTATAGG + Intergenic
1023340782 7:39217113-39217135 GTTGCCAAGGTTCGGTTTATGGG + Intronic
1056767855 9:89455674-89455696 AGTGGTAAGGGTCGGTTTAGGGG - Intronic
1058322853 9:103656490-103656512 TCTGCTAAGGGCCTGTTTTTGGG + Intergenic
1060736960 9:126072102-126072124 ACTGCTAAGGGCCAGGTTCTGGG - Intergenic
1185664532 X:1754954-1754976 ATTGCTGAGGTCAGGTGTATAGG - Intergenic
1188878223 X:35459580-35459602 ATTGCTAATGTCTGGTATATAGG - Intergenic