ID: 931881658

View in Genome Browser
Species Human (GRCh38)
Location 2:66576226-66576248
Sequence GACTCAGGGGTAGCACGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931881658_931881671 18 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881671 2:66576267-66576289 CGGCCTAGGCCCCAGTGCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 68
931881658_931881663 -8 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881663 2:66576241-66576263 CCTGAGTCCCTCGATGCGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 107
931881658_931881661 -9 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881661 2:66576240-66576262 CCCTGAGTCCCTCGATGCGCTGG 0: 1
1: 1
2: 0
3: 1
4: 62
931881658_931881674 22 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881674 2:66576271-66576293 CTAGGCCCCAGTGCGTGGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 134
931881658_931881667 4 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881667 2:66576253-66576275 GATGCGCTGGGTCCCGGCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 131
931881658_931881670 17 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881670 2:66576266-66576288 CCGGCCTAGGCCCCAGTGCGTGG 0: 1
1: 0
2: 3
3: 14
4: 251
931881658_931881673 21 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881673 2:66576270-66576292 CCTAGGCCCCAGTGCGTGGGCGG 0: 1
1: 0
2: 0
3: 17
4: 150
931881658_931881664 -2 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881664 2:66576247-66576269 TCCCTCGATGCGCTGGGTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 67
931881658_931881675 26 Left 931881658 2:66576226-66576248 CCAGGACGTGCTACCCCTGAGTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 931881675 2:66576275-66576297 GCCCCAGTGCGTGGGCGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931881658 Original CRISPR GACTCAGGGGTAGCACGTCC TGG (reversed) Intergenic
906803611 1:48758909-48758931 GCCGCAGGAGCAGCACGTCCTGG + Exonic
916510088 1:165465738-165465760 GTCTCAGCTGTAGCAGGTCCAGG - Intergenic
918047911 1:180952512-180952534 GCCTCAGGCGTATCACCTCCCGG + Intergenic
921030346 1:211330681-211330703 GACTGAGGAGTACCAGGTCCTGG - Intronic
922886476 1:229024649-229024671 GCCTCAGGTGGAGCAGGTCCTGG - Intergenic
923054988 1:230419528-230419550 GACTCAGGGGATACATGTCCAGG - Intronic
1064048880 10:12043040-12043062 GACTCTGGGGTGGCGGGTCCGGG + Intronic
1073070514 10:100790572-100790594 AACTCAGGAGTAGCAGGGCCCGG - Intronic
1074782060 10:116809139-116809161 GACTCAGGGGAGCCACTTCCCGG + Intergenic
1084738701 11:71123469-71123491 GAGTCTGGGGTAGGACTTCCAGG + Intronic
1088764862 11:112964167-112964189 GACTCAAATGTAGCATGTCCAGG + Intronic
1096477756 12:51918855-51918877 CTCTCAGGGGTAGCGTGTCCAGG + Intronic
1101447674 12:104748944-104748966 TACTCAGGGGTAGCCAGCCCAGG + Intronic
1104709617 12:130976447-130976469 GACTCAGAATCAGCACGTCCTGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1109787384 13:67196398-67196420 GACTCAGGAGTAAAACATCCTGG - Intronic
1112675667 13:101698897-101698919 GACTCATGGGTAGCTATTCCAGG - Intronic
1112931489 13:104744812-104744834 GACTCAGGGGAATCACTTCCAGG - Intergenic
1121116865 14:91349920-91349942 GACTCAGAGTTAGCAAGTCGGGG - Intronic
1129706619 15:77798186-77798208 GACACAGGGGTAGCAGAGCCTGG + Intronic
1132463515 16:67118-67140 GACTCAGAGGTGGCCCCTCCTGG - Intronic
1132681061 16:1141937-1141959 GACTCAGGGGCAGCAGGGACGGG - Intergenic
1141907466 16:87036830-87036852 GACTCAGGTGAAGCAGGTGCCGG - Intergenic
1150677886 17:67260612-67260634 GACTCAGGGGAGTCATGTCCTGG + Intergenic
1160711725 19:554935-554957 CACTTTGGGGTGGCACGTCCTGG + Intergenic
1162189966 19:8937227-8937249 GACTCATGGGTCGCTCATCCTGG - Exonic
1164579958 19:29428928-29428950 GGCGCAGGGGTAGCAGGTGCAGG + Intergenic
1164757873 19:30703685-30703707 GACTCAGGGGAAGCTCTGCCTGG - Intronic
1165991321 19:39816294-39816316 GTCTCAGGGGTGGCCCCTCCAGG - Intergenic
925845047 2:8027322-8027344 GACTCAAGGGGAGCAGGTCGTGG - Intergenic
927854709 2:26520695-26520717 GACTCAGGGGCAGCAGCTCCAGG - Intronic
928164315 2:28958671-28958693 AATTCAGGGGAAGCACGACCAGG + Intronic
931881658 2:66576226-66576248 GACTCAGGGGTAGCACGTCCTGG - Intergenic
932779914 2:74553620-74553642 GACCCAGGGGCAGCGCCTCCCGG + Intronic
936389150 2:112055773-112055795 GACCCAGGCGTGGCACGTCTCGG + Intronic
940854884 2:158722323-158722345 GCCTCAGGGGCAGCAGGTCCAGG + Intergenic
947998705 2:234549570-234549592 GATTCAGGGGTTACACGTGCAGG + Intergenic
948315780 2:237027280-237027302 GACTCAAGGGTAGAACTTCAGGG + Intergenic
1169088122 20:2839986-2840008 GCCTCAGGGCTAGCCCCTCCGGG + Intronic
1169092896 20:2872355-2872377 GACTCAGGGGTTGCCCGGTCTGG + Intronic
1172161290 20:32870246-32870268 GACACAGTGGTGGCACTTCCTGG - Intronic
1175480356 20:59306320-59306342 GACTCAAGGGCAGCACTTCTGGG - Intronic
1176063499 20:63182451-63182473 GTTTCAGGGGGAGCACGGCCAGG + Intergenic
1178318396 21:31586084-31586106 GACTTTGGGGGAGCAGGTCCAGG + Intergenic
1179024352 21:37667623-37667645 GGCACCGGGGTAGCAGGTCCAGG + Intronic
1183072578 22:35406710-35406732 GACTCACGTGTTGCACTTCCTGG - Exonic
1184983591 22:48114137-48114159 GCCATAAGGGTAGCACGTCCTGG + Intergenic
954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG + Intergenic
961528346 3:127523491-127523513 GACTCACGGATAGCCCTTCCTGG - Intergenic
968866241 4:3213846-3213868 CACTGAGGGGCAGCGCGTCCAGG - Intronic
969149422 4:5156371-5156393 GACTCAGGGTTAGCACGCAGAGG + Intronic
972407914 4:38764067-38764089 GGCTCAGGGGTAGTGAGTCCAGG + Intergenic
985620502 5:952440-952462 GACTCAGGGGCACCAGGTTCAGG - Intergenic
986065271 5:4229056-4229078 GATTCAGGGGGCACACGTCCTGG - Intergenic
991580030 5:68145219-68145241 GATTCAGGGGGTGCATGTCCAGG - Intergenic
992691471 5:79244716-79244738 GATTCAGAGGAAGCAGGTCCTGG - Intronic
994688145 5:102982429-102982451 GTATCAGTGGTAGCAGGTCCAGG - Intronic
1001409234 5:171498424-171498446 GCATCAGGGGTAGCAAGGCCAGG + Intergenic
1001529677 5:172453541-172453563 GGCTCAGAGGTTGCAGGTCCTGG - Intronic
1001961037 5:175880501-175880523 GAGTCAGGGGAAGCCTGTCCCGG + Exonic
1017961878 6:159230509-159230531 GATTCAGGGGCTGCACGTGCAGG - Intronic
1019359841 7:599050-599072 GCCTCATGGGCAGCGCGTCCTGG - Intronic
1026598161 7:71751848-71751870 GACTCAGGGGCAGCATGTGCAGG + Intergenic
1032529547 7:132608959-132608981 GCCTCAGGGGTGGCAGTTCCTGG - Intronic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1039921605 8:41897244-41897266 GGCTCGGGAGTAGCGCGTCCGGG - Intergenic
1040603089 8:48903692-48903714 GTCTCAGGAGTAGCAAGGCCAGG - Intergenic
1048172025 8:132116479-132116501 GACTCAGGGGTAGGTGGTCCTGG + Intergenic
1048965258 8:139610168-139610190 GACCCAGAGGTAGCAGCTCCTGG - Intronic
1057197070 9:93121163-93121185 GACTCAGGGGCAGCACCTCAAGG + Intergenic
1060538777 9:124415210-124415232 GACTCAGGGGAATCAGGGCCTGG - Intronic
1062712029 9:137980534-137980556 GATTCAGGGGTTACACGTGCAGG + Intronic
1185927555 X:4164056-4164078 GACTCAGGGGGTACACGTGCAGG - Intergenic
1195834827 X:109102547-109102569 GACTCCTGGGTGGCACGTCTGGG - Intergenic
1199157745 X:144570599-144570621 GACTAAGTGGTAGCAGGTCAAGG - Intergenic
1200147127 X:153932157-153932179 CAGGGAGGGGTAGCACGTCCAGG + Intronic