ID: 931881951

View in Genome Browser
Species Human (GRCh38)
Location 2:66577544-66577566
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931881951_931881960 22 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data
931881951_931881953 -9 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881953 2:66577558-66577580 AGTCCCGGGACCTCGCCGATTGG No data
931881951_931881954 -8 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881954 2:66577559-66577581 GTCCCGGGACCTCGCCGATTGGG No data
931881951_931881955 -7 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881955 2:66577560-66577582 TCCCGGGACCTCGCCGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931881951 Original CRISPR CCCGGGACTCGTTTTCCGCC TGG (reversed) Intergenic