ID: 931881953 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:66577558-66577580 |
Sequence | AGTCCCGGGACCTCGCCGAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931881951_931881953 | -9 | Left | 931881951 | 2:66577544-66577566 | CCAGGCGGAAAACGAGTCCCGGG | No data | ||
Right | 931881953 | 2:66577558-66577580 | AGTCCCGGGACCTCGCCGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931881953 | Original CRISPR | AGTCCCGGGACCTCGCCGAT TGG | Intergenic | ||