ID: 931881955

View in Genome Browser
Species Human (GRCh38)
Location 2:66577560-66577582
Sequence TCCCGGGACCTCGCCGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931881951_931881955 -7 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881955 2:66577560-66577582 TCCCGGGACCTCGCCGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931881955 Original CRISPR TCCCGGGACCTCGCCGATTG GGG Intergenic