ID: 931881960

View in Genome Browser
Species Human (GRCh38)
Location 2:66577589-66577611
Sequence TGAATAAAGTCACCTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931881951_931881960 22 Left 931881951 2:66577544-66577566 CCAGGCGGAAAACGAGTCCCGGG No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data
931881956_931881960 5 Left 931881956 2:66577561-66577583 CCCGGGACCTCGCCGATTGGGGA No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data
931881957_931881960 4 Left 931881957 2:66577562-66577584 CCGGGACCTCGCCGATTGGGGAA No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data
931881958_931881960 -2 Left 931881958 2:66577568-66577590 CCTCGCCGATTGGGGAAGCAGTG No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data
931881959_931881960 -7 Left 931881959 2:66577573-66577595 CCGATTGGGGAAGCAGTGAATAA No data
Right 931881960 2:66577589-66577611 TGAATAAAGTCACCTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931881960 Original CRISPR TGAATAAAGTCACCTGCTTC AGG Intergenic