ID: 931891319

View in Genome Browser
Species Human (GRCh38)
Location 2:66675610-66675632
Sequence GTGTTTGTTACCTACCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931891319_931891320 0 Left 931891319 2:66675610-66675632 CCGGGGAGGTAGGTAACAAACAC No data
Right 931891320 2:66675633-66675655 TTTCTCTTAGTAACTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931891319 Original CRISPR GTGTTTGTTACCTACCTCCC CGG (reversed) Intergenic
No off target data available for this crispr