ID: 931893506

View in Genome Browser
Species Human (GRCh38)
Location 2:66702575-66702597
Sequence CAGATTTATGGGTCCAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931893506_931893518 25 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893518 2:66702623-66702645 GATAAGCAGGGGCAGAGATAGGG No data
931893506_931893515 13 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893515 2:66702611-66702633 CCTATATATTCAGATAAGCAGGG No data
931893506_931893517 24 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893517 2:66702622-66702644 AGATAAGCAGGGGCAGAGATAGG No data
931893506_931893513 12 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893513 2:66702610-66702632 GCCTATATATTCAGATAAGCAGG No data
931893506_931893519 26 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893519 2:66702624-66702646 ATAAGCAGGGGCAGAGATAGGGG No data
931893506_931893512 -10 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893512 2:66702588-66702610 CATAAATCTGAGCAAAGGGCAGG No data
931893506_931893516 14 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931893506 Original CRISPR CAGATTTATGGGTCCAGCAA GGG (reversed) Intergenic
No off target data available for this crispr