ID: 931893511

View in Genome Browser
Species Human (GRCh38)
Location 2:66702587-66702609
Sequence CTGCCCTTTGCTCAGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931893511_931893513 0 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893513 2:66702610-66702632 GCCTATATATTCAGATAAGCAGG No data
931893511_931893522 27 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893522 2:66702637-66702659 GAGATAGGGGCTTGAAAGGAGGG No data
931893511_931893519 14 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893519 2:66702624-66702646 ATAAGCAGGGGCAGAGATAGGGG No data
931893511_931893515 1 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893515 2:66702611-66702633 CCTATATATTCAGATAAGCAGGG No data
931893511_931893517 12 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893517 2:66702622-66702644 AGATAAGCAGGGGCAGAGATAGG No data
931893511_931893518 13 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893518 2:66702623-66702645 GATAAGCAGGGGCAGAGATAGGG No data
931893511_931893521 26 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893521 2:66702636-66702658 AGAGATAGGGGCTTGAAAGGAGG No data
931893511_931893520 23 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893520 2:66702633-66702655 GGCAGAGATAGGGGCTTGAAAGG No data
931893511_931893516 2 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931893511 Original CRISPR CTGCCCTTTGCTCAGATTTA TGG (reversed) Intergenic
No off target data available for this crispr