ID: 931893516

View in Genome Browser
Species Human (GRCh38)
Location 2:66702612-66702634
Sequence CTATATATTCAGATAAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931893510_931893516 3 Left 931893510 2:66702586-66702608 CCCATAAATCTGAGCAAAGGGCA No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data
931893511_931893516 2 Left 931893511 2:66702587-66702609 CCATAAATCTGAGCAAAGGGCAG No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data
931893506_931893516 14 Left 931893506 2:66702575-66702597 CCCTTGCTGGACCCATAAATCTG No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data
931893507_931893516 13 Left 931893507 2:66702576-66702598 CCTTGCTGGACCCATAAATCTGA No data
Right 931893516 2:66702612-66702634 CTATATATTCAGATAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931893516 Original CRISPR CTATATATTCAGATAAGCAG GGG Intergenic
No off target data available for this crispr