ID: 931894892

View in Genome Browser
Species Human (GRCh38)
Location 2:66717734-66717756
Sequence TGGTCCTGCTCTCATGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931894892_931894893 -7 Left 931894892 2:66717734-66717756 CCTCTGTCATGAGAGCAGGACCA No data
Right 931894893 2:66717750-66717772 AGGACCAGCTATATGATTTGTGG No data
931894892_931894894 -6 Left 931894892 2:66717734-66717756 CCTCTGTCATGAGAGCAGGACCA No data
Right 931894894 2:66717751-66717773 GGACCAGCTATATGATTTGTGGG No data
931894892_931894895 -5 Left 931894892 2:66717734-66717756 CCTCTGTCATGAGAGCAGGACCA No data
Right 931894895 2:66717752-66717774 GACCAGCTATATGATTTGTGGGG No data
931894892_931894896 -4 Left 931894892 2:66717734-66717756 CCTCTGTCATGAGAGCAGGACCA No data
Right 931894896 2:66717753-66717775 ACCAGCTATATGATTTGTGGGGG No data
931894892_931894900 23 Left 931894892 2:66717734-66717756 CCTCTGTCATGAGAGCAGGACCA No data
Right 931894900 2:66717780-66717802 CAATGCAAAATGAAAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931894892 Original CRISPR TGGTCCTGCTCTCATGACAG AGG (reversed) Intergenic