ID: 931896910

View in Genome Browser
Species Human (GRCh38)
Location 2:66742601-66742623
Sequence CTAATTCACCAGATATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931896910_931896914 19 Left 931896910 2:66742601-66742623 CCAAGAGATATCTGGTGAATTAG No data
Right 931896914 2:66742643-66742665 GATTTTCCAAGGTAACTGAGTGG No data
931896910_931896912 8 Left 931896910 2:66742601-66742623 CCAAGAGATATCTGGTGAATTAG No data
Right 931896912 2:66742632-66742654 AATTTCCTTCAGATTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931896910 Original CRISPR CTAATTCACCAGATATCTCT TGG (reversed) Intergenic
No off target data available for this crispr