ID: 931904411 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:66826807-66826829 |
| Sequence | GATAATGCACAGAAACAGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931904406_931904411 | 28 | Left | 931904406 | 2:66826756-66826778 | CCAGCATATTCATCCTGAAATCA | No data | ||
| Right | 931904411 | 2:66826807-66826829 | GATAATGCACAGAAACAGCATGG | No data | ||||
| 931904410_931904411 | 15 | Left | 931904410 | 2:66826769-66826791 | CCTGAAATCATTTGGGGAAAGAT | No data | ||
| Right | 931904411 | 2:66826807-66826829 | GATAATGCACAGAAACAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931904411 | Original CRISPR | GATAATGCACAGAAACAGCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||