ID: 931904411

View in Genome Browser
Species Human (GRCh38)
Location 2:66826807-66826829
Sequence GATAATGCACAGAAACAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931904406_931904411 28 Left 931904406 2:66826756-66826778 CCAGCATATTCATCCTGAAATCA No data
Right 931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG No data
931904410_931904411 15 Left 931904410 2:66826769-66826791 CCTGAAATCATTTGGGGAAAGAT No data
Right 931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931904411 Original CRISPR GATAATGCACAGAAACAGCA TGG Intergenic
No off target data available for this crispr