ID: 931904652

View in Genome Browser
Species Human (GRCh38)
Location 2:66829561-66829583
Sequence GGGCTAAGAGTAAAGAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931904652_931904659 13 Left 931904652 2:66829561-66829583 CCATACCTCTTTACTCTTAGCCC No data
Right 931904659 2:66829597-66829619 GGCACTGACTTTATTCCCAGGGG No data
931904652_931904658 12 Left 931904652 2:66829561-66829583 CCATACCTCTTTACTCTTAGCCC No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data
931904652_931904657 11 Left 931904652 2:66829561-66829583 CCATACCTCTTTACTCTTAGCCC No data
Right 931904657 2:66829595-66829617 ATGGCACTGACTTTATTCCCAGG No data
931904652_931904654 -8 Left 931904652 2:66829561-66829583 CCATACCTCTTTACTCTTAGCCC No data
Right 931904654 2:66829576-66829598 CTTAGCCCATTTACTCACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931904652 Original CRISPR GGGCTAAGAGTAAAGAGGTA TGG (reversed) Intergenic
No off target data available for this crispr