ID: 931904656

View in Genome Browser
Species Human (GRCh38)
Location 2:66829582-66829604
Sequence TCAGTGCCATCGTGAGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931904656_931904658 -9 Left 931904656 2:66829582-66829604 CCATTTACTCACGATGGCACTGA No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data
931904656_931904657 -10 Left 931904656 2:66829582-66829604 CCATTTACTCACGATGGCACTGA No data
Right 931904657 2:66829595-66829617 ATGGCACTGACTTTATTCCCAGG No data
931904656_931904659 -8 Left 931904656 2:66829582-66829604 CCATTTACTCACGATGGCACTGA No data
Right 931904659 2:66829597-66829619 GGCACTGACTTTATTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931904656 Original CRISPR TCAGTGCCATCGTGAGTAAA TGG (reversed) Intergenic
No off target data available for this crispr