ID: 931904658

View in Genome Browser
Species Human (GRCh38)
Location 2:66829596-66829618
Sequence TGGCACTGACTTTATTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931904655_931904658 -8 Left 931904655 2:66829581-66829603 CCCATTTACTCACGATGGCACTG No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data
931904652_931904658 12 Left 931904652 2:66829561-66829583 CCATACCTCTTTACTCTTAGCCC No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data
931904656_931904658 -9 Left 931904656 2:66829582-66829604 CCATTTACTCACGATGGCACTGA No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data
931904653_931904658 7 Left 931904653 2:66829566-66829588 CCTCTTTACTCTTAGCCCATTTA No data
Right 931904658 2:66829596-66829618 TGGCACTGACTTTATTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931904658 Original CRISPR TGGCACTGACTTTATTCCCA GGG Intergenic
No off target data available for this crispr