ID: 931906492

View in Genome Browser
Species Human (GRCh38)
Location 2:66848956-66848978
Sequence ATTTTAACCAGACTAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931906488_931906492 9 Left 931906488 2:66848924-66848946 CCAAATTTCAATAGTGCCGAGGG No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906481_931906492 22 Left 931906481 2:66848911-66848933 CCCCTCCATGACCCCAAATTTCA No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906490_931906492 -7 Left 931906490 2:66848940-66848962 CCGAGGGTTAGAAACCATTTTAA No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906482_931906492 21 Left 931906482 2:66848912-66848934 CCCTCCATGACCCCAAATTTCAA No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906486_931906492 10 Left 931906486 2:66848923-66848945 CCCAAATTTCAATAGTGCCGAGG No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906484_931906492 17 Left 931906484 2:66848916-66848938 CCATGACCCCAAATTTCAATAGT No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906485_931906492 11 Left 931906485 2:66848922-66848944 CCCCAAATTTCAATAGTGCCGAG No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data
931906483_931906492 20 Left 931906483 2:66848913-66848935 CCTCCATGACCCCAAATTTCAAT No data
Right 931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931906492 Original CRISPR ATTTTAACCAGACTAAAATG TGG Intergenic
No off target data available for this crispr