ID: 931906982

View in Genome Browser
Species Human (GRCh38)
Location 2:66853191-66853213
Sequence CTGTGACAATGGGAAGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931906982_931906986 -4 Left 931906982 2:66853191-66853213 CCTTCCGCTTCCCATTGTCACAG No data
Right 931906986 2:66853210-66853232 ACAGCAGTTCATGTTTATCGTGG No data
931906982_931906987 -3 Left 931906982 2:66853191-66853213 CCTTCCGCTTCCCATTGTCACAG No data
Right 931906987 2:66853211-66853233 CAGCAGTTCATGTTTATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931906982 Original CRISPR CTGTGACAATGGGAAGCGGA AGG (reversed) Intergenic
No off target data available for this crispr