ID: 931908023

View in Genome Browser
Species Human (GRCh38)
Location 2:66863680-66863702
Sequence CAGGGTTATCAATTTTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931908013_931908023 22 Left 931908013 2:66863635-66863657 CCATGTAAGGTCCCAGCACACTC No data
Right 931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG No data
931908012_931908023 23 Left 931908012 2:66863634-66863656 CCCATGTAAGGTCCCAGCACACT No data
Right 931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG No data
931908015_931908023 10 Left 931908015 2:66863647-66863669 CCAGCACACTCATGAGTCTGAGA No data
Right 931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG No data
931908014_931908023 11 Left 931908014 2:66863646-66863668 CCCAGCACACTCATGAGTCTGAG No data
Right 931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931908023 Original CRISPR CAGGGTTATCAATTTTCAGT GGG Intergenic
No off target data available for this crispr