ID: 931910535

View in Genome Browser
Species Human (GRCh38)
Location 2:66894787-66894809
Sequence CTGCATCTGCATAAAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931910533_931910535 0 Left 931910533 2:66894764-66894786 CCTTTCATGACTCTGGGCTGCAA No data
Right 931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG No data
931910530_931910535 12 Left 931910530 2:66894752-66894774 CCTTGGGCAAATCCTTTCATGAC No data
Right 931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG No data
931910529_931910535 25 Left 931910529 2:66894739-66894761 CCTACTTGTGTGACCTTGGGCAA No data
Right 931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931910535 Original CRISPR CTGCATCTGCATAAAGTGAA GGG Intergenic
No off target data available for this crispr