ID: 931912318

View in Genome Browser
Species Human (GRCh38)
Location 2:66914128-66914150
Sequence AATTGTCCAGGGAGGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931912309_931912318 14 Left 931912309 2:66914091-66914113 CCAATAATCTGGAGCTCCCAGTA No data
Right 931912318 2:66914128-66914150 AATTGTCCAGGGAGGAGAGTGGG No data
931912312_931912318 -2 Left 931912312 2:66914107-66914129 CCCAGTAACATAGAAAGGGAGAA No data
Right 931912318 2:66914128-66914150 AATTGTCCAGGGAGGAGAGTGGG No data
931912313_931912318 -3 Left 931912313 2:66914108-66914130 CCAGTAACATAGAAAGGGAGAAT No data
Right 931912318 2:66914128-66914150 AATTGTCCAGGGAGGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931912318 Original CRISPR AATTGTCCAGGGAGGAGAGT GGG Intergenic
No off target data available for this crispr