ID: 931913969

View in Genome Browser
Species Human (GRCh38)
Location 2:66932908-66932930
Sequence CAGCCACAATGGCCCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931913969_931913974 -5 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913974 2:66932926-66932948 GGCTGGATTAAAGGAAGCTTGGG No data
931913969_931913977 11 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913977 2:66932942-66932964 GCTTGGGGAGAAAGGTAATGAGG No data
931913969_931913976 3 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913976 2:66932934-66932956 TAAAGGAAGCTTGGGGAGAAAGG No data
931913969_931913978 24 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913978 2:66932955-66932977 GGTAATGAGGTTAGTGAGACAGG No data
931913969_931913973 -6 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913973 2:66932925-66932947 TGGCTGGATTAAAGGAAGCTTGG No data
931913969_931913975 -4 Left 931913969 2:66932908-66932930 CCAAAGGAGGGCCATTGTGGCTG No data
Right 931913975 2:66932927-66932949 GCTGGATTAAAGGAAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931913969 Original CRISPR CAGCCACAATGGCCCTCCTT TGG (reversed) Intergenic
No off target data available for this crispr