ID: 931920190

View in Genome Browser
Species Human (GRCh38)
Location 2:67006812-67006834
Sequence ATGCCCATATTCACTCTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920188_931920190 15 Left 931920188 2:67006774-67006796 CCACACAATCACAGGGTTTTGTT No data
Right 931920190 2:67006812-67006834 ATGCCCATATTCACTCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920190 Original CRISPR ATGCCCATATTCACTCTGTT CGG Intergenic
No off target data available for this crispr