ID: 931920490

View in Genome Browser
Species Human (GRCh38)
Location 2:67009888-67009910
Sequence GGGAGGTGATTAGCTCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920490_931920497 -6 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920497 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
931920490_931920494 -8 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920494 2:67009903-67009925 CACCTCCCTCCCTCAACACATGG No data
931920490_931920504 22 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920490_931920503 21 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920490_931920502 2 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920502 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
931920490_931920495 -7 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920495 2:67009904-67009926 ACCTCCCTCCCTCAACACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920490 Original CRISPR GGGAGGTGATTAGCTCATGG GGG (reversed) Intergenic