ID: 931920491

View in Genome Browser
Species Human (GRCh38)
Location 2:67009889-67009911
Sequence AGGGAGGTGATTAGCTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920491_931920495 -8 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920495 2:67009904-67009926 ACCTCCCTCCCTCAACACATGGG No data
931920491_931920497 -7 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920497 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
931920491_931920502 1 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920502 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
931920491_931920503 20 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920491_931920504 21 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920491_931920494 -9 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920494 2:67009903-67009925 CACCTCCCTCCCTCAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920491 Original CRISPR AGGGAGGTGATTAGCTCATG GGG (reversed) Intergenic