ID: 931920493

View in Genome Browser
Species Human (GRCh38)
Location 2:67009891-67009913
Sequence GGAGGGAGGTGATTAGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920493_931920504 19 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920493_931920495 -10 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920495 2:67009904-67009926 ACCTCCCTCCCTCAACACATGGG No data
931920493_931920503 18 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920493_931920497 -9 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920497 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
931920493_931920502 -1 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920502 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920493 Original CRISPR GGAGGGAGGTGATTAGCTCA TGG (reversed) Intergenic