ID: 931920496

View in Genome Browser
Species Human (GRCh38)
Location 2:67009905-67009927
Sequence CCCCATGTGTTGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920496_931920504 5 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920496_931920503 4 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920496_931920510 29 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920496 Original CRISPR CCCCATGTGTTGAGGGAGGG AGG (reversed) Intergenic