ID: 931920498

View in Genome Browser
Species Human (GRCh38)
Location 2:67009908-67009930
Sequence AATCCCCATGTGTTGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920498_931920511 30 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920498_931920510 26 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920498_931920504 2 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920498_931920503 1 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920498 Original CRISPR AATCCCCATGTGTTGAGGGA GGG (reversed) Intergenic