ID: 931920499

View in Genome Browser
Species Human (GRCh38)
Location 2:67009909-67009931
Sequence CAATCCCCATGTGTTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920499_931920504 1 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data
931920499_931920512 30 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920499_931920511 29 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920499_931920503 0 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920499_931920510 25 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920499 Original CRISPR CAATCCCCATGTGTTGAGGG AGG (reversed) Intergenic