ID: 931920500

View in Genome Browser
Species Human (GRCh38)
Location 2:67009912-67009934
Sequence CTGCAATCCCCATGTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920500_931920503 -3 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920500_931920510 22 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920500_931920511 26 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920500_931920504 -2 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG 0: 1
1: 0
2: 5
3: 39
4: 487
931920500_931920512 27 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920500_931920513 28 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920500 Original CRISPR CTGCAATCCCCATGTGTTGA GGG (reversed) Intergenic