ID: 931920501

View in Genome Browser
Species Human (GRCh38)
Location 2:67009913-67009935
Sequence CCTGCAATCCCCATGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920501_931920511 25 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920501_931920510 21 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920501_931920503 -4 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920501_931920512 26 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920501_931920513 27 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920501_931920504 -3 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920504 2:67009933-67009955 AGGTCCCTCCCTTGACCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920501 Original CRISPR CCTGCAATCCCCATGTGTTG AGG (reversed) Intergenic