ID: 931920503

View in Genome Browser
Species Human (GRCh38)
Location 2:67009932-67009954
Sequence CAGGTCCCTCCCTTGACCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920500_931920503 -3 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920489_931920503 24 Left 931920489 2:67009885-67009907 CCGCCCCCATGAGCTAATCACCT No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920496_931920503 4 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920498_931920503 1 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920492_931920503 19 Left 931920492 2:67009890-67009912 CCCATGAGCTAATCACCTCCCTC No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920493_931920503 18 Left 931920493 2:67009891-67009913 CCATGAGCTAATCACCTCCCTCC No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920501_931920503 -4 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920499_931920503 0 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920490_931920503 21 Left 931920490 2:67009888-67009910 CCCCCATGAGCTAATCACCTCCC No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data
931920491_931920503 20 Left 931920491 2:67009889-67009911 CCCCATGAGCTAATCACCTCCCT No data
Right 931920503 2:67009932-67009954 CAGGTCCCTCCCTTGACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920503 Original CRISPR CAGGTCCCTCCCTTGACCGT AGG Intergenic