ID: 931920505

View in Genome Browser
Species Human (GRCh38)
Location 2:67009937-67009959
Sequence TAATCCCTACGGTCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920505_931920514 29 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920514 2:67009989-67010011 CAGAGCCAAACCATAGCAGTTGG No data
931920505_931920513 3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG 0: 67
1: 811
2: 2695
3: 11320
4: 13537
931920505_931920512 2 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920505_931920511 1 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG 0: 61
1: 861
2: 2922
3: 11764
4: 14927
931920505_931920510 -3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920505_931920515 30 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920505 Original CRISPR TAATCCCTACGGTCAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr