ID: 931920505

View in Genome Browser
Species Human (GRCh38)
Location 2:67009937-67009959
Sequence TAATCCCTACGGTCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920505_931920514 29 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920514 2:67009989-67010011 CAGAGCCAAACCATAGCAGTTGG No data
931920505_931920512 2 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920505_931920515 30 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920505_931920511 1 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920505_931920513 3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920505_931920510 -3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920505 Original CRISPR TAATCCCTACGGTCAAGGGA GGG (reversed) Intergenic