ID: 931920506

View in Genome Browser
Species Human (GRCh38)
Location 2:67009938-67009960
Sequence GTAATCCCTACGGTCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920506_931920512 1 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920506_931920514 28 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920514 2:67009989-67010011 CAGAGCCAAACCATAGCAGTTGG No data
931920506_931920515 29 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920506_931920511 0 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920506_931920510 -4 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920506_931920513 2 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920506 Original CRISPR GTAATCCCTACGGTCAAGGG AGG (reversed) Intergenic