ID: 931920508

View in Genome Browser
Species Human (GRCh38)
Location 2:67009942-67009964
Sequence AATTGTAATCCCTACGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920508_931920511 -4 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920508_931920510 -8 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920508_931920517 29 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920517 2:67009994-67010016 CCAAACCATAGCAGTTGGGTTGG No data
931920508_931920512 -3 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG No data
931920508_931920514 24 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920514 2:67009989-67010011 CAGAGCCAAACCATAGCAGTTGG No data
931920508_931920518 30 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920518 2:67009995-67010017 CAAACCATAGCAGTTGGGTTGGG No data
931920508_931920515 25 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920508_931920513 -2 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920508 Original CRISPR AATTGTAATCCCTACGGTCA AGG (reversed) Intergenic