ID: 931920510

View in Genome Browser
Species Human (GRCh38)
Location 2:67009957-67009979
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920500_931920510 22 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920496_931920510 29 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920498_931920510 26 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920506_931920510 -4 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920505_931920510 -3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920507_931920510 -7 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920501_931920510 21 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920499_931920510 25 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data
931920508_931920510 -8 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type