ID: 931920510

View in Genome Browser
Species Human (GRCh38)
Location 2:67009957-67009979
Sequence TTACAATTTGAGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31931
Summary {0: 683, 1: 2082, 2: 4985, 3: 11931, 4: 12250}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920496_931920510 29 Left 931920496 2:67009905-67009927 CCTCCCTCCCTCAACACATGGGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920505_931920510 -3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920500_931920510 22 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920506_931920510 -4 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920498_931920510 26 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT 0: 145
1: 751
2: 3027
3: 5778
4: 7706
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920501_931920510 21 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920507_931920510 -7 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920508_931920510 -8 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250
931920499_931920510 25 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG 0: 7
1: 197
2: 979
3: 3753
4: 6735
Right 931920510 2:67009957-67009979 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920510 Original CRISPR TTACAATTTGAGATGAGATT TGG Intergenic
Too many off-targets to display for this crispr