ID: 931920511

View in Genome Browser
Species Human (GRCh38)
Location 2:67009961-67009983
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920508_931920511 -4 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920507_931920511 -3 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920509_931920511 -10 Left 931920509 2:67009948-67009970 CCGTAGGGATTACAATTTGAGAT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920499_931920511 29 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920505_931920511 1 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920501_931920511 25 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920506_931920511 0 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920498_931920511 30 Left 931920498 2:67009908-67009930 CCCTCCCTCAACACATGGGGATT No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data
931920500_931920511 26 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920511 2:67009961-67009983 AATTTGAGATGAGATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type