ID: 931920512

View in Genome Browser
Species Human (GRCh38)
Location 2:67009962-67009984
Sequence ATTTGAGATGAGATTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28675
Summary {0: 63, 1: 861, 2: 2732, 3: 11581, 4: 13438}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920500_931920512 27 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920505_931920512 2 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920506_931920512 1 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920509_931920512 -9 Left 931920509 2:67009948-67009970 CCGTAGGGATTACAATTTGAGAT No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920508_931920512 -3 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920501_931920512 26 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920507_931920512 -2 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438
931920499_931920512 30 Left 931920499 2:67009909-67009931 CCTCCCTCAACACATGGGGATTG 0: 7
1: 197
2: 979
3: 3753
4: 6735
Right 931920512 2:67009962-67009984 ATTTGAGATGAGATTTGGATGGG 0: 63
1: 861
2: 2732
3: 11581
4: 13438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920512 Original CRISPR ATTTGAGATGAGATTTGGAT GGG Intergenic
Too many off-targets to display for this crispr