ID: 931920513

View in Genome Browser
Species Human (GRCh38)
Location 2:67009963-67009985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920505_931920513 3 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920507_931920513 -1 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920508_931920513 -2 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920509_931920513 -8 Left 931920509 2:67009948-67009970 CCGTAGGGATTACAATTTGAGAT No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920500_931920513 28 Left 931920500 2:67009912-67009934 CCCTCAACACATGGGGATTGCAG No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920501_931920513 27 Left 931920501 2:67009913-67009935 CCTCAACACATGGGGATTGCAGG No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data
931920506_931920513 2 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920513 2:67009963-67009985 TTTGAGATGAGATTTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type