ID: 931920515

View in Genome Browser
Species Human (GRCh38)
Location 2:67009990-67010012
Sequence AGAGCCAAACCATAGCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931920505_931920515 30 Left 931920505 2:67009937-67009959 CCCTCCCTTGACCGTAGGGATTA No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920507_931920515 26 Left 931920507 2:67009941-67009963 CCCTTGACCGTAGGGATTACAAT No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920508_931920515 25 Left 931920508 2:67009942-67009964 CCTTGACCGTAGGGATTACAATT No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920506_931920515 29 Left 931920506 2:67009938-67009960 CCTCCCTTGACCGTAGGGATTAC No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data
931920509_931920515 19 Left 931920509 2:67009948-67009970 CCGTAGGGATTACAATTTGAGAT No data
Right 931920515 2:67009990-67010012 AGAGCCAAACCATAGCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931920515 Original CRISPR AGAGCCAAACCATAGCAGTT GGG Intergenic
No off target data available for this crispr