ID: 931927463

View in Genome Browser
Species Human (GRCh38)
Location 2:67088824-67088846
Sequence TGAACTCTGATTTCAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931927457_931927463 8 Left 931927457 2:67088793-67088815 CCTTTGAGGCCCAGTATCTCATT No data
Right 931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG No data
931927458_931927463 -1 Left 931927458 2:67088802-67088824 CCCAGTATCTCATTCCCTCAGCT No data
Right 931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG No data
931927459_931927463 -2 Left 931927459 2:67088803-67088825 CCAGTATCTCATTCCCTCAGCTG No data
Right 931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931927463 Original CRISPR TGAACTCTGATTTCAACAGG AGG Intergenic
No off target data available for this crispr