ID: 931934259

View in Genome Browser
Species Human (GRCh38)
Location 2:67178422-67178444
Sequence CAGCACAGGTTGCATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931934259_931934267 30 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934267 2:67178475-67178497 CCAAATGGGGTAGGAGAGTATGG No data
931934259_931934265 21 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data
931934259_931934263 16 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934263 2:67178461-67178483 ACTAATGAAATTAACCAAATGGG No data
931934259_931934264 17 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934264 2:67178462-67178484 CTAATGAAATTAACCAAATGGGG No data
931934259_931934262 15 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934262 2:67178460-67178482 CACTAATGAAATTAACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931934259 Original CRISPR CAGCACAGGTTGCATATATT GGG (reversed) Intergenic
No off target data available for this crispr