ID: 931934260

View in Genome Browser
Species Human (GRCh38)
Location 2:67178423-67178445
Sequence ACAGCACAGGTTGCATATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931934260_931934264 16 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934264 2:67178462-67178484 CTAATGAAATTAACCAAATGGGG No data
931934260_931934267 29 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934267 2:67178475-67178497 CCAAATGGGGTAGGAGAGTATGG No data
931934260_931934263 15 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934263 2:67178461-67178483 ACTAATGAAATTAACCAAATGGG No data
931934260_931934265 20 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data
931934260_931934262 14 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934262 2:67178460-67178482 CACTAATGAAATTAACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931934260 Original CRISPR ACAGCACAGGTTGCATATAT TGG (reversed) Intergenic
No off target data available for this crispr