ID: 931934261

View in Genome Browser
Species Human (GRCh38)
Location 2:67178436-67178458
Sequence TTATAATGATTTCACAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931934261_931934267 16 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934267 2:67178475-67178497 CCAAATGGGGTAGGAGAGTATGG No data
931934261_931934268 26 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934268 2:67178485-67178507 TAGGAGAGTATGGCATATGCAGG No data
931934261_931934264 3 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934264 2:67178462-67178484 CTAATGAAATTAACCAAATGGGG No data
931934261_931934262 1 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934262 2:67178460-67178482 CACTAATGAAATTAACCAAATGG No data
931934261_931934263 2 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934263 2:67178461-67178483 ACTAATGAAATTAACCAAATGGG No data
931934261_931934265 7 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931934261 Original CRISPR TTATAATGATTTCACAGCAC AGG (reversed) Intergenic
No off target data available for this crispr