ID: 931934265

View in Genome Browser
Species Human (GRCh38)
Location 2:67178466-67178488
Sequence TGAAATTAACCAAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931934259_931934265 21 Left 931934259 2:67178422-67178444 CCCAATATATGCAACCTGTGCTG No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data
931934260_931934265 20 Left 931934260 2:67178423-67178445 CCAATATATGCAACCTGTGCTGT No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data
931934261_931934265 7 Left 931934261 2:67178436-67178458 CCTGTGCTGTGAAATCATTATAA No data
Right 931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931934265 Original CRISPR TGAAATTAACCAAATGGGGT AGG Intergenic
No off target data available for this crispr